Search for Variation information by Variation ID:
Detailed information for vg1121947207:
| Variant ID: vg1121947207 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21947207 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AAGAATCAAGCTCCTACAGCCGATGATGCTGCAGCCGATGAAGCGAAGAGGTTGGCAAAAGGAAAGAGTGTTGTTACAGCACCAATCAACATGGTCTTTA[C/T]
GCTACCAGCCGAATTTGGAATCAATCAGGCCGATGTTGATGAAGTAGAGGAGGAATCGGCCAAGTTGGTCCTGTCACCAGAGCAAGCGGTATTCGAAAAG
Reverse complement sequence
CTTTTCGAATACCGCTTGCTCTGGTGACAGGACCAACTTGGCCGATTCCTCCTCTACTTCATCAACATCGGCCTGATTGATTCCAAATTCGGCTGGTAGC[G/A]
TAAAGACCATGTTGATTGGTGCTGTAACAACACTCTTTCCTTTTGCCAACCTCTTCGCTTCATCGGCTGCAGCATCATCGGCTGTAGGAGCTTGATTCTT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 6.90% | 0.34% | 2.05% | NA |
| All Indica | 2759 | 97.40% | 0.70% | 0.18% | 1.78% | NA |
| All Japonica | 1512 | 83.30% | 15.00% | 0.26% | 1.46% | NA |
| Aus | 269 | 90.30% | 0.40% | 2.23% | 7.06% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 95.90% | 1.10% | 0.33% | 2.63% | NA |
| Indica Intermediate | 786 | 95.90% | 0.90% | 0.25% | 2.93% | NA |
| Temperate Japonica | 767 | 92.00% | 7.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 67.10% | 28.80% | 0.60% | 3.57% | NA |
| Japonica Intermediate | 241 | 89.20% | 9.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 28.10% | 67.70% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 81.10% | 14.40% | 1.11% | 3.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121947207 | C -> T | LOC_Os11g37170.1 | missense_variant ; p.Thr715Met; MODERATE | nonsynonymous_codon ; T715M | Average:37.392; most accessible tissue: Minghui63 flag leaf, score: 48.324 | benign  |
0.874 |
TOLERATED | 0.19 |
| vg1121947207 | C -> DEL | LOC_Os11g37170.1 | N | frameshift_variant | Average:37.392; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121947207 | NA | 4.12E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 3.13E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 6.97E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 1.61E-09 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 5.46E-10 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 4.02E-06 | mr1470 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | 4.76E-07 | 4.75E-07 | mr1481 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 7.89E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 2.47E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947207 | NA | 8.81E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |