\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121927907:

Variant ID: vg1121927907 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 21927907
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCGCCGGTCCAATCTCCGCCACCGCAGCCTCGAGCTCGTATAGAGCTTTGCCACCGGAGCTCGACGCCCTCTGGCCTCTGCCCTCCACCGCTGCTCCC[T/C,TC]
TCTCCTCCGGCCCACCACCACGTACGCCAATGACGGCGACGAACCAGCGACGGCGCGGCTGACGCGGGCGGCGATGGACGGGCAATGGCGAGGCTGACGC

Reverse complement sequence

GCGTCAGCCTCGCCATTGCCCGTCCATCGCCGCCCGCGTCAGCCGCGCCGTCGCTGGTTCGTCGCCGTCATTGGCGTACGTGGTGGTGGGCCGGAGGAGA[A/G,GA]
GGGAGCAGCGGTGGAGGGCAGAGGCCAGAGGGCGTCGAGCTCCGGTGGCAAAGCTCTATACGAGCTCGAGGCTGCGGTGGCGGAGATTGGACCGGCGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 15.10% 0.11% 5.14% TC: 2.69%
All Indica  2759 90.80% 0.80% 0.07% 3.99% TC: 4.35%
All Japonica  1512 52.60% 44.70% 0.00% 2.45% TC: 0.26%
Aus  269 70.60% 2.20% 0.74% 26.39% NA
Indica I  595 83.00% 0.50% 0.17% 0.34% TC: 15.97%
Indica II  465 97.60% 0.00% 0.22% 0.43% TC: 1.72%
Indica III  913 91.30% 1.10% 0.00% 7.56% NA
Indica Intermediate  786 92.00% 1.10% 0.00% 4.71% TC: 2.16%
Temperate Japonica  767 30.50% 68.80% 0.00% 0.39% TC: 0.26%
Tropical Japonica  504 84.30% 10.10% 0.00% 5.36% TC: 0.20%
Japonica Intermediate  241 56.40% 40.20% 0.00% 2.90% TC: 0.41%
VI/Aromatic  96 79.20% 1.00% 0.00% 19.79% NA
Intermediate  90 77.80% 11.10% 1.11% 6.67% TC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121927907 T -> TC LOC_Os11g37140.1 frameshift_variant ; p.Gly81fs; HIGH frameshift_variant Average:76.344; most accessible tissue: Zhenshan97 young leaf, score: 93.079 N N N N
vg1121927907 T -> DEL LOC_Os11g37140.1 N frameshift_variant Average:76.344; most accessible tissue: Zhenshan97 young leaf, score: 93.079 N N N N
vg1121927907 T -> C LOC_Os11g37140.1 synonymous_variant ; p.Glu80Glu; LOW synonymous_codon Average:76.344; most accessible tissue: Zhenshan97 young leaf, score: 93.079 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121927907 T C 0.01 0.01 0.0 0.01 0.0 0.0
vg1121927907 T TC -0.03 -0.01 -0.04 0.0 -0.05 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121927907 NA 1.91E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 4.32E-08 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 5.55E-15 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.04E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 6.37E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.70E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 2.76E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 2.76E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 4.45E-06 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.46E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 5.06E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 4.45E-06 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 6.19E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 6.84E-12 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 7.20E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 3.34E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 2.81E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 2.00E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 7.75E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 2.58E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.06E-08 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 8.03E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.47E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 3.14E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 5.93E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 1.44E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 9.65E-08 mr1965 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 4.68E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121927907 NA 4.97E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251