Variant ID: vg1121882641 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 21882641 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACAAGGTTGACTTGGTAGCGAGAATGCTCGTGGAAGCATGCGACTTGGGTGAGAATGTGCTGATTCTTGGGCACAACCAATCGCTTTGTCTCCGTGCTGA[T/A]
GAATATCCTCTGCTGAAGGCGAATCATGTCTACTTCAGTGATGATAGAGAGCTCTATATTAAAGGATGCAAGAATGGCTGCCGTGATATTGGAGTGTTCA
TGAACACTCCAATATCACGGCAGCCATTCTTGCATCCTTTAATATAGAGCTCTCTATCATCACTGAAGTAGACATGATTCGCCTTCAGCAGAGGATATTC[A/T]
TCAGCACGGAGACAAAGCGATTGGTTGTGCCCAAGAATCAGCACATTCTCACCCAAGTCGCATGCTTCCACGAGCATTCTCGCTACCAAGTCAACCTTGT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 72.10% | 27.70% | 0.21% | 0.00% | NA |
All Indica | 2759 | 93.90% | 5.90% | 0.22% | 0.00% | NA |
All Japonica | 1512 | 32.50% | 67.50% | 0.07% | 0.00% | NA |
Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.40% | 2.20% | 0.43% | 0.00% | NA |
Indica III | 913 | 93.80% | 5.90% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 90.20% | 9.70% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 16.30% | 83.70% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 62.90% | 36.90% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 63.30% | 33.30% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1121882641 | T -> A | LOC_Os11g37060.1 | missense_variant ; p.Asp342Glu; MODERATE | nonsynonymous_codon ; D342E | Average:20.167; most accessible tissue: Zhenshan97 root, score: 38.035 | benign | 0.266 | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1121882641 | NA | 1.25E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | 7.60E-06 | 2.85E-20 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | NA | 2.93E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | NA | 3.80E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | NA | 8.22E-08 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | 7.86E-08 | 9.82E-26 | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | NA | 3.61E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | NA | 7.91E-08 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121882641 | 1.61E-06 | 1.61E-06 | mr1760_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |