| Variant ID: vg1121710869 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21710869 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.23, T: 0.00, others allele: 0.00, population size: 209. )
CTCTCGCTGCTCCTGCTTGCACTCTGAGCCCCGTTTTCTCATGCTCATGCTCAAGAAGGAGCGCTCGAGTAGCCAAGAGATGGAATGCGAGGCATCTTAT[A/G,T]
GACTAGGAAAATATTTTTTTGTGCTCATGTCATGTGGTACGCCAATGCATAAAACTAATGTGCCATTGCTACCGTGGAGTAAAGCTATGTGGAATATACA
TGTATATTCCACATAGCTTTACTCCACGGTAGCAATGGCACATTAGTTTTATGCATTGGCGTACCACATGACATGAGCACAAAAAAATATTTTCCTAGTC[T/C,A]
ATAAGATGCCTCGCATTCCATCTCTTGGCTACTCGAGCGCTCCTTCTTGAGCATGAGCATGAGAAAACGGGGCTCAGAGTGCAAGCAGGAGCAGCGAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 26.00% | 0.17% | 0.02% | T: 2.33% |
| All Indica | 2759 | 59.20% | 38.30% | 0.14% | 0.04% | T: 2.36% |
| All Japonica | 1512 | 96.70% | 2.60% | 0.07% | 0.00% | T: 0.60% |
| Aus | 269 | 78.10% | 10.00% | 1.12% | 0.00% | T: 10.78% |
| Indica I | 595 | 68.20% | 31.40% | 0.00% | 0.00% | T: 0.34% |
| Indica II | 465 | 44.70% | 55.10% | 0.00% | 0.00% | T: 0.22% |
| Indica III | 913 | 64.40% | 29.70% | 0.33% | 0.11% | T: 5.48% |
| Indica Intermediate | 786 | 54.80% | 43.50% | 0.13% | 0.00% | T: 1.53% |
| Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 1.20% | 0.00% | 0.00% | T: 1.59% |
| Japonica Intermediate | 241 | 94.60% | 4.60% | 0.41% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 10.40% | 85.40% | 0.00% | 0.00% | T: 4.17% |
| Intermediate | 90 | 72.20% | 24.40% | 0.00% | 0.00% | T: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121710869 | A -> T | LOC_Os11g36770.1 | upstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> T | LOC_Os11g36760.1 | downstream_gene_variant ; 2840.0bp to feature; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> T | LOC_Os11g36760-LOC_Os11g36770 | intergenic_region ; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> DEL | N | N | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> G | LOC_Os11g36770.1 | upstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> G | LOC_Os11g36760.1 | downstream_gene_variant ; 2840.0bp to feature; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg1121710869 | A -> G | LOC_Os11g36760-LOC_Os11g36770 | intergenic_region ; MODIFIER | silent_mutation | Average:49.098; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121710869 | 2.64E-08 | 4.00E-09 | mr1517 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121710869 | 1.67E-08 | 2.40E-09 | mr1538 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121710869 | NA | 1.07E-11 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121710869 | NA | 3.09E-08 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121710869 | 8.20E-06 | 8.20E-06 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |