Variant ID: vg1121618472 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 21618472 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.19, others allele: 0.00, population size: 47. )
AATACGCACGGCGAGAACTCTTACACGACCAGATCTTACATGGTCTTTTGTCTCTACAGGATCTGACAAGGCCTTATCGGCTTTGGGTGTCCCCAGCCGA[C/A]
GATCCCTTAGGTTCCTCGGAGGCCTTGTCAAGACAGCGTAAAGGGACATAAGGACAGGTTTCAACGCTAGGTGTCATCAGGGTAAGGGATCATCGGGTGA
TCACCCGATGATCCCTTACCCTGATGACACCTAGCGTTGAAACCTGTCCTTATGTCCCTTTACGCTGTCTTGACAAGGCCTCCGAGGAACCTAAGGGATC[G/T]
TCGGCTGGGGACACCCAAAGCCGATAAGGCCTTGTCAGATCCTGTAGAGACAAAAGACCATGTAAGATCTGGTCGTGTAAGAGTTCTCGCCGTGCGTATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 30.30% | 1.00% | 55.46% | 13.25% | NA |
All Indica | 2759 | 10.20% | 1.40% | 80.86% | 7.58% | NA |
All Japonica | 1512 | 71.60% | 0.10% | 4.89% | 23.48% | NA |
Aus | 269 | 12.60% | 2.60% | 69.52% | 15.24% | NA |
Indica I | 595 | 19.00% | 0.50% | 52.94% | 27.56% | NA |
Indica II | 465 | 8.40% | 1.30% | 88.60% | 1.72% | NA |
Indica III | 913 | 2.50% | 2.40% | 94.63% | 0.44% | NA |
Indica Intermediate | 786 | 13.50% | 0.90% | 81.42% | 4.20% | NA |
Temperate Japonica | 767 | 81.90% | 0.00% | 3.26% | 14.86% | NA |
Tropical Japonica | 504 | 56.90% | 0.20% | 7.54% | 35.32% | NA |
Japonica Intermediate | 241 | 69.30% | 0.00% | 4.56% | 26.14% | NA |
VI/Aromatic | 96 | 3.10% | 2.10% | 88.54% | 6.25% | NA |
Intermediate | 90 | 34.40% | 0.00% | 48.89% | 16.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1121618472 | C -> A | LOC_Os11g36630.1 | downstream_gene_variant ; 436.0bp to feature; MODIFIER | silent_mutation | Average:12.915; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
vg1121618472 | C -> A | LOC_Os11g36640.1 | downstream_gene_variant ; 540.0bp to feature; MODIFIER | silent_mutation | Average:12.915; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
vg1121618472 | C -> A | LOC_Os11g36630-LOC_Os11g36640 | intergenic_region ; MODIFIER | silent_mutation | Average:12.915; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
vg1121618472 | C -> DEL | N | N | silent_mutation | Average:12.915; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1121618472 | NA | 2.59E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121618472 | NA | 5.25E-10 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121618472 | 7.74E-06 | NA | mr1718_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |