Search for Variation information by Variation ID:
Detailed information for vg1121337815:
| Variant ID: vg1121337815 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21337815 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CATGCAGTCGTTCCTCGACGGCATCGTGCACCCGAAGGGCTGGGTGGAGTGGGACAAGAGCAAGCACGTCTTGGAGACGACCAAGACCGTGTCGTACATG[A/G]
AGTTCAACAATACGGGACCCGGATCGGACACCAGCCGCCGCGTCAACTGGGAGGGCTTCTCCGTGGTCGACGCTAGCAAAGCTGAGGAGTACACCGTCGA
Reverse complement sequence
TCGACGGTGTACTCCTCAGCTTTGCTAGCGTCGACCACGGAGAAGCCCTCCCAGTTGACGCGGCGGCTGGTGTCCGATCCGGGTCCCGTATTGTTGAACT[T/C]
CATGTACGACACGGTCTTGGTCGTCTCCAAGACGTGCTTGCTCTTGTCCCACTCCACCCAGCCCTTCGGGTGCACGATGCCGTCGAGGAACGACTGCATG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 27.60% | 1.23% | 2.90% | NA |
| All Indica | 2759 | 92.60% | 6.40% | 0.43% | 0.58% | NA |
| All Japonica | 1512 | 27.40% | 69.80% | 1.65% | 1.12% | NA |
| Aus | 269 | 40.10% | 15.20% | 6.69% | 37.92% | NA |
| Indica I | 595 | 79.20% | 20.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.70% | 1.50% | 0.43% | 2.37% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 93.60% | 5.00% | 0.89% | 0.51% | NA |
| Temperate Japonica | 767 | 11.70% | 84.70% | 1.43% | 2.09% | NA |
| Tropical Japonica | 504 | 45.40% | 53.60% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 39.40% | 56.40% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 32.20% | 3.33% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121337815 | A -> DEL | LOC_Os11g36240.1 | N | frameshift_variant | Average:80.686; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1121337815 | A -> G | LOC_Os11g36240.1 | missense_variant ; p.Lys318Glu; MODERATE | nonsynonymous_codon ; K318E | Average:80.686; most accessible tissue: Zhenshan97 panicle, score: 85.254 | possibly damaging  |
-1.626 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121337815 | 4.31E-06 | 4.31E-06 | mr1393 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 4.91E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 5.70E-07 | mr1561 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | 2.74E-06 | 2.74E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 5.82E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 3.05E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 3.51E-07 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | 3.78E-06 | 2.35E-23 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 1.82E-06 | mr1698_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | 3.55E-06 | 3.55E-06 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121337815 | NA | 7.94E-07 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |