Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1120970935:

Variant ID: vg1120970935 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20970935
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTGTGTGGTGTACTGTAGTAGAAAGAGAAGAAGGGGAGGAGGAAGGGGGGAGAGGAGGGAGGAGTATATACTATAGGAGAGGGGAAGGGGGTGATCG[A/C]
TGGGAGCGATCACCCGCCCAACAGGATTTCCAAACACTAGAGTCATTGGCGGAAAAAAAATTCCATTCTTGAAATAAGTTTTTTTAGGTAAGTTTTTAAA

Reverse complement sequence

TTTAAAAACTTACCTAAAAAAACTTATTTCAAGAATGGAATTTTTTTTCCGCCAATGACTCTAGTGTTTGGAAATCCTGTTGGGCGGGTGATCGCTCCCA[T/G]
CGATCACCCCCTTCCCCTCTCCTATAGTATATACTCCTCCCTCCTCTCCCCCCTTCCTCCTCCCCTTCTTCTCTTTCTACTACAGTACACCACACAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	36.20%	1.93%	1.86%	NA
All Indica	2759	90.20%	6.40%	2.14%	1.30%	NA
All Japonica	1512	4.80%	90.10%	1.85%	3.24%	NA
Aus	269	80.70%	18.20%	0.74%	0.37%	NA
Indica I	595	77.30%	18.30%	4.37%	0.00%	NA
Indica II	465	94.20%	1.30%	1.72%	2.80%	NA
Indica III	913	97.20%	1.50%	0.22%	1.10%	NA
Indica Intermediate	786	89.40%	6.00%	2.93%	1.65%	NA
Temperate Japonica	767	5.00%	92.00%	2.61%	0.39%	NA
Tropical Japonica	504	3.60%	85.90%	1.39%	9.13%	NA
Japonica Intermediate	241	7.10%	92.50%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	46.70%	48.90%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120970935	A -> DEL	N	N	silent_mutation	Average:67.435; most accessible tissue: Callus, score: 96.548	N	N	N	N
vg1120970935	A -> C	LOC_Os11g35730.1	upstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Callus, score: 96.548	N	N	N	N
vg1120970935	A -> C	LOC_Os11g35720-LOC_Os11g35730	intergenic_region ; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Callus, score: 96.548	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1120970935	A	C	-0.01	-0.02	-0.01	0.0	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120970935	NA	2.09E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	NA	5.04E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	1.93E-06	NA	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	1.32E-06	6.84E-06	mr1211_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	NA	4.17E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	1.08E-06	1.08E-06	mr1527_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	NA	8.10E-06	mr1577_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120970935	NA	4.41E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251