\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120916800:

Variant ID: vg1120916800 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20916800
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTCAATCGTCTGGCTCGTTATGCTCCGGAAGATGTGCGCAATGTTGAAGAGCGCCAAGAGAAGTTCTTGGAAGGACTTAATGAGGAGCTTTCTTACC[C/T]
ACTCATGACTGGAGATTATTCTGATTTCCAGAAGTTGGTGGATAAGGCTATTCGTCAGGAAGACAAGTACAATCGCATGGAGCAGAAGAAACGTCGGATT

Reverse complement sequence

AATCCGACGTTTCTTCTGCTCCATGCGATTGTACTTGTCTTCCTGACGAATAGCCTTATCCACCAACTTCTGGAAATCAGAATAATCTCCAGTCATGAGT[G/A]
GGTAAGAAAGCTCCTCATTAAGTCCTTCCAAGAACTTCTCTTGGCGCTCTTCAACATTGCGCACATCTTCCGGAGCATAACGAGCCAGACGATTGAACTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 14.20% 4.21% 0.49% NA
All Indica  2759 96.40% 0.60% 3.01% 0.00% NA
All Japonica  1512 54.60% 37.40% 6.61% 1.46% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 94.10% 0.00% 5.88% 0.00% NA
Indica II  465 94.40% 0.60% 4.95% 0.00% NA
Indica III  913 99.10% 0.20% 0.66% 0.00% NA
Indica Intermediate  786 96.20% 1.40% 2.42% 0.00% NA
Temperate Japonica  767 81.10% 12.00% 5.08% 1.83% NA
Tropical Japonica  504 24.20% 66.30% 7.94% 1.59% NA
Japonica Intermediate  241 33.60% 57.70% 8.71% 0.00% NA
VI/Aromatic  96 21.90% 70.80% 7.29% 0.00% NA
Intermediate  90 67.80% 24.40% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120916800 C -> T LOC_Os11g35680.1 missense_variant ; p.Pro508Leu; MODERATE nonsynonymous_codon ; P508L Average:24.869; most accessible tissue: Minghui63 young leaf, score: 43.347 possibly damaging 1.972 DELETERIOUS 0.01
vg1120916800 C -> DEL LOC_Os11g35680.1 N frameshift_variant Average:24.869; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120916800 NA 4.48E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.34E-14 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 1.76E-06 NA mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 6.39E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.25E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.56E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.78E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 4.67E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 2.40E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.28E-13 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 4.59E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.19E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 8.77E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 2.60E-15 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 5.29E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.95E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.27E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 6.27E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.86E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 7.45E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.97E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 8.14E-15 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 3.95E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.80E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 8.78E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.05E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 1.66E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 4.19E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 4.02E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800 NA 2.19E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251