Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120916800:

Variant ID: vg1120916800 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20916800
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTTCAATCGTCTGGCTCGTTATGCTCCGGAAGATGTGCGCAATGTTGAAGAGCGCCAAGAGAAGTTCTTGGAAGGACTTAATGAGGAGCTTTCTTACC[C/T]
ACTCATGACTGGAGATTATTCTGATTTCCAGAAGTTGGTGGATAAGGCTATTCGTCAGGAAGACAAGTACAATCGCATGGAGCAGAAGAAACGTCGGATT

Reverse complement sequence

AATCCGACGTTTCTTCTGCTCCATGCGATTGTACTTGTCTTCCTGACGAATAGCCTTATCCACCAACTTCTGGAAATCAGAATAATCTCCAGTCATGAGT[G/A]
GGTAAGAAAGCTCCTCATTAAGTCCTTCCAAGAACTTCTCTTGGCGCTCTTCAACATTGCGCACATCTTCCGGAGCATAACGAGCCAGACGATTGAACTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	14.20%	4.21%	0.49%	NA
All Indica	2759	96.40%	0.60%	3.01%	0.00%	NA
All Japonica	1512	54.60%	37.40%	6.61%	1.46%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	94.10%	0.00%	5.88%	0.00%	NA
Indica II	465	94.40%	0.60%	4.95%	0.00%	NA
Indica III	913	99.10%	0.20%	0.66%	0.00%	NA
Indica Intermediate	786	96.20%	1.40%	2.42%	0.00%	NA
Temperate Japonica	767	81.10%	12.00%	5.08%	1.83%	NA
Tropical Japonica	504	24.20%	66.30%	7.94%	1.59%	NA
Japonica Intermediate	241	33.60%	57.70%	8.71%	0.00%	NA
VI/Aromatic	96	21.90%	70.80%	7.29%	0.00%	NA
Intermediate	90	67.80%	24.40%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120916800	C -> T	LOC_Os11g35680.1	missense_variant ; p.Pro508Leu; MODERATE	nonsynonymous_codon ; P508L	Average:24.869; most accessible tissue: Minghui63 young leaf, score: 43.347	possibly damaging	1.972	DELETERIOUS	0.01
vg1120916800	C -> DEL	LOC_Os11g35680.1	N	frameshift_variant	Average:24.869; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120916800	NA	4.48E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.34E-14	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	1.76E-06	NA	mr1115	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	6.39E-15	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.25E-06	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.56E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.78E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	4.67E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	2.40E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.28E-13	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	4.59E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.19E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	8.77E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	2.60E-15	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	5.29E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.95E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.27E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	6.27E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.86E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	7.45E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.97E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	8.14E-15	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	3.95E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.80E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	8.78E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.05E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	1.66E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	4.19E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	4.02E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120916800	NA	2.19E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251