Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1120840098:

Variant ID: vg1120840098 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20840098
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTCCGCATAATATAAGGGATTTTCGACTTTTTACTTGTAATGTTTAACTACTTGTCTTATTAAAAAATTTATACAAATATAAAAAATAAAAAAATATG[T/C]
TTAAAGTACTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTCCAAAATTTTTTGAATAAGACGAATAGTCAAATAGTGCAAGCAAAAAGT

Reverse complement sequence

ACTTTTTGCTTGCACTATTTGACTATTCGTCTTATTCAAAAAATTTTGGAATTATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAGTACTTTAA[A/G]
CATATTTTTTTATTTTTTATATTTGTATAAATTTTTTAATAAGACAAGTAGTTAAACATTACAAGTAAAAAGTCGAAAATCCCTTATATTATGCGGACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	26.40%	2.73%	2.01%	NA
All Indica	2759	76.70%	19.90%	1.41%	2.03%	NA
All Japonica	1512	49.30%	44.40%	4.96%	1.39%	NA
Aus	269	90.30%	2.20%	1.49%	5.95%	NA
Indica I	595	74.50%	23.90%	1.68%	0.00%	NA
Indica II	465	72.90%	26.20%	0.65%	0.22%	NA
Indica III	913	83.20%	11.90%	0.99%	3.83%	NA
Indica Intermediate	786	73.00%	22.30%	2.16%	2.54%	NA
Temperate Japonica	767	20.70%	73.10%	6.00%	0.13%	NA
Tropical Japonica	504	86.10%	6.90%	3.17%	3.77%	NA
Japonica Intermediate	241	63.10%	31.10%	5.39%	0.41%	NA
VI/Aromatic	96	95.80%	1.00%	3.12%	0.00%	NA
Intermediate	90	62.20%	26.70%	8.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120840098	T -> DEL	N	N	silent_mutation	Average:54.765; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1120840098	T -> C	LOC_Os11g35540.1	upstream_gene_variant ; 4249.0bp to feature; MODIFIER	silent_mutation	Average:54.765; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1120840098	T -> C	LOC_Os11g35550.1	upstream_gene_variant ; 647.0bp to feature; MODIFIER	silent_mutation	Average:54.765; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1120840098	T -> C	LOC_Os11g35560.1	downstream_gene_variant ; 4785.0bp to feature; MODIFIER	silent_mutation	Average:54.765; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1120840098	T -> C	LOC_Os11g35550-LOC_Os11g35560	intergenic_region ; MODIFIER	silent_mutation	Average:54.765; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120840098	NA	2.57E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120840098	NA	5.09E-06	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120840098	NA	1.46E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120840098	1.04E-06	1.04E-06	mr1966	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120840098	NA	1.82E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251