\
| Variant ID: vg1120734654 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20734654 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAGTGCCCAGACGAAAAAAACGAAAAATACGCACGCAAGCGCCATGCAAAATCAGCAAAAAAAAAAATCAGCCCACCAAGTATCTAACCCAAGCACTCA[G/A]
CCTTCAAACCTCGCTGCACTAGCCATTTGAGCTCTGTTTGCTTCTCAAATGAATGCACCCGCACCCTCATTTAATAGGGGCAAACATGGAAGAATAGTCT
AGACTATTCTTCCATGTTTGCCCCTATTAAATGAGGGTGCGGGTGCATTCATTTGAGAAGCAAACAGAGCTCAAATGGCTAGTGCAGCGAGGTTTGAAGG[C/T]
TGAGTGCTTGGGTTAGATACTTGGTGGGCTGATTTTTTTTTTTGCTGATTTTGCATGGCGCTTGCGTGCGTATTTTTCGTTTTTTTCGTCTGGGCACTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 6.30% | 0.44% | 0.91% | NA |
| All Indica | 2759 | 93.90% | 4.40% | 0.29% | 1.45% | NA |
| All Japonica | 1512 | 98.10% | 1.30% | 0.66% | 0.00% | NA |
| Aus | 269 | 41.60% | 56.90% | 0.37% | 1.12% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.30% | 1.30% | 0.44% | 2.96% | NA |
| Indica Intermediate | 786 | 92.00% | 6.00% | 0.38% | 1.65% | NA |
| Temperate Japonica | 767 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120734654 | G -> A | LOC_Os11g35380.1 | upstream_gene_variant ; 302.0bp to feature; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> A | LOC_Os11g35360.1 | downstream_gene_variant ; 3113.0bp to feature; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> A | LOC_Os11g35370.1 | downstream_gene_variant ; 1975.0bp to feature; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> A | LOC_Os11g35390.1 | downstream_gene_variant ; 437.0bp to feature; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> A | LOC_Os11g35360.2 | downstream_gene_variant ; 3113.0bp to feature; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> A | LOC_Os11g35380-LOC_Os11g35390 | intergenic_region ; MODIFIER | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg1120734654 | G -> DEL | N | N | silent_mutation | Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120734654 | NA | 1.65E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | NA | 1.03E-09 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | NA | 2.12E-10 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | 7.09E-07 | 1.01E-12 | mr1889 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | 1.09E-06 | 3.14E-11 | mr1896 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | NA | 6.18E-10 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120734654 | NA | 2.79E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |