\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120734654:

Variant ID: vg1120734654 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20734654
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGCCCAGACGAAAAAAACGAAAAATACGCACGCAAGCGCCATGCAAAATCAGCAAAAAAAAAAATCAGCCCACCAAGTATCTAACCCAAGCACTCA[G/A]
CCTTCAAACCTCGCTGCACTAGCCATTTGAGCTCTGTTTGCTTCTCAAATGAATGCACCCGCACCCTCATTTAATAGGGGCAAACATGGAAGAATAGTCT

Reverse complement sequence

AGACTATTCTTCCATGTTTGCCCCTATTAAATGAGGGTGCGGGTGCATTCATTTGAGAAGCAAACAGAGCTCAAATGGCTAGTGCAGCGAGGTTTGAAGG[C/T]
TGAGTGCTTGGGTTAGATACTTGGTGGGCTGATTTTTTTTTTTGCTGATTTTGCATGGCGCTTGCGTGCGTATTTTTCGTTTTTTTCGTCTGGGCACTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 6.30% 0.44% 0.91% NA
All Indica  2759 93.90% 4.40% 0.29% 1.45% NA
All Japonica  1512 98.10% 1.30% 0.66% 0.00% NA
Aus  269 41.60% 56.90% 0.37% 1.12% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 86.70% 13.10% 0.22% 0.00% NA
Indica III  913 95.30% 1.30% 0.44% 2.96% NA
Indica Intermediate  786 92.00% 6.00% 0.38% 1.65% NA
Temperate Japonica  767 97.70% 2.20% 0.13% 0.00% NA
Tropical Japonica  504 98.20% 0.00% 1.79% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120734654 G -> A LOC_Os11g35380.1 upstream_gene_variant ; 302.0bp to feature; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> A LOC_Os11g35360.1 downstream_gene_variant ; 3113.0bp to feature; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> A LOC_Os11g35370.1 downstream_gene_variant ; 1975.0bp to feature; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> A LOC_Os11g35390.1 downstream_gene_variant ; 437.0bp to feature; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> A LOC_Os11g35360.2 downstream_gene_variant ; 3113.0bp to feature; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> A LOC_Os11g35380-LOC_Os11g35390 intergenic_region ; MODIFIER silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1120734654 G -> DEL N N silent_mutation Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120734654 NA 1.65E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 NA 1.03E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 NA 2.12E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 7.09E-07 1.01E-12 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 1.09E-06 3.14E-11 mr1896 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 NA 6.18E-10 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654 NA 2.79E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251