Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120726313:

Variant ID: vg1120726313 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20726313
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGCTCCAAGAAAACTGTTTGACCCAACACGAAAAAAAAACGTGCTTATAAAAAGTCCGGTTTGGCACTGTGCAATGCGAAAAAAAAACTATCTGATTT[C/G,T]
AGGAAAAAAAAACATCCGATTCCATGAAAAATAATCATATCGTTTGTATTGTCCATCATCTACTGCGTAGGTTTGGTTTTTCCAAAACGTTCATGGAATG

Reverse complement sequence

CATTCCATGAACGTTTTGGAAAAACCAAACCTACGCAGTAGATGATGGACAATACAAACGATATGATTATTTTTCATGGAATCGGATGTTTTTTTTTCCT[G/C,A]
AAATCAGATAGTTTTTTTTTCGCATTGCACAGTGCCAAACCGGACTTTTTATAAGCACGTTTTTTTTTCGTGTTGGGTCAAACAGTTTTCTTGGAGCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	19.20%	2.90%	0.89%	T: 0.19%
All Indica	2759	95.40%	1.20%	2.03%	1.38%	NA
All Japonica	1512	46.90%	48.40%	3.97%	0.13%	T: 0.60%
Aus	269	80.70%	13.00%	6.32%	0.00%	NA
Indica I	595	97.50%	1.70%	0.67%	0.17%	NA
Indica II	465	91.60%	0.90%	4.73%	2.80%	NA
Indica III	913	97.60%	0.50%	1.31%	0.55%	NA
Indica Intermediate	786	93.60%	1.70%	2.29%	2.42%	NA
Temperate Japonica	767	72.10%	22.20%	5.61%	0.13%	NA
Tropical Japonica	504	16.70%	80.00%	1.59%	0.00%	T: 1.79%
Japonica Intermediate	241	29.90%	66.00%	3.73%	0.41%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	61.10%	32.20%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120726313	C -> T	LOC_Os11g35350.1	upstream_gene_variant ; 1694.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> T	LOC_Os11g35360.1	upstream_gene_variant ; 3219.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> T	LOC_Os11g35360.2	upstream_gene_variant ; 3219.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> T	LOC_Os11g35340.1	downstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> T	LOC_Os11g35350-LOC_Os11g35360	intergenic_region ; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> DEL	N	N	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> G	LOC_Os11g35350.1	upstream_gene_variant ; 1694.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> G	LOC_Os11g35360.1	upstream_gene_variant ; 3219.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> G	LOC_Os11g35360.2	upstream_gene_variant ; 3219.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> G	LOC_Os11g35340.1	downstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N
vg1120726313	C -> G	LOC_Os11g35350-LOC_Os11g35360	intergenic_region ; MODIFIER	silent_mutation	Average:36.588; most accessible tissue: Callus, score: 71.318	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120726313	NA	2.23E-14	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.71E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.52E-17	mr1205	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	7.34E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	4.23E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	3.00E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.11E-08	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.68E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.92E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	3.16E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.59E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	2.21E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	7.09E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.61E-15	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.44E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	4.48E-06	mr1565	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.31E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	9.34E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	4.84E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	3.90E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.48E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	4.94E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.76E-07	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	7.80E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	5.72E-15	mr1775	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	7.94E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	8.51E-10	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	1.87E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	9.09E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	9.09E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	3.87E-09	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	2.20E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	9.19E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.28E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.58E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.83E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	9.45E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	9.35E-06	9.35E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	9.14E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120726313	NA	6.90E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251