\
| Variant ID: vg1120471729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20471729 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCAAAAAAATTCCGAGCGTACAAGCTCAATCATTACATACAAGTTTACAAACAAAAGTAGCACATAAGCTCGAGCACCTTACATAACACTGAAAGAGTA[G/A]
AAAGACTCCAACACCGTTCAAGGTGAAAAGACTTTCCAAATAAACCAACAACCACATTACTCCATTAACTGCTTTCTCCTGTTCCATCCATCTTTATTAC
GTAATAAAGATGGATGGAACAGGAGAAAGCAGTTAATGGAGTAATGTGGTTGTTGGTTTATTTGGAAAGTCTTTTCACCTTGAACGGTGTTGGAGTCTTT[C/T]
TACTCTTTCAGTGTTATGTAAGGTGCTCGAGCTTATGTGCTACTTTTGTTTGTAAACTTGTATGTAATGATTGAGCTTGTACGCTCGGAATTTTTTTGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 4.30% | 0.87% | 22.05% | NA |
| All Indica | 2759 | 69.10% | 0.30% | 0.80% | 29.83% | NA |
| All Japonica | 1512 | 81.90% | 12.50% | 0.00% | 5.62% | NA |
| Aus | 269 | 51.30% | 0.00% | 6.69% | 42.01% | NA |
| Indica I | 595 | 53.40% | 0.30% | 1.34% | 44.87% | NA |
| Indica II | 465 | 79.40% | 0.00% | 0.86% | 19.78% | NA |
| Indica III | 913 | 67.30% | 0.30% | 0.77% | 31.65% | NA |
| Indica Intermediate | 786 | 77.10% | 0.30% | 0.38% | 22.26% | NA |
| Temperate Japonica | 767 | 73.10% | 22.90% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 88.90% | 1.00% | 0.00% | 10.12% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.30% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 83.30% | 7.80% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120471729 | G -> A | LOC_Os11g34930.1 | upstream_gene_variant ; 1227.0bp to feature; MODIFIER | silent_mutation | Average:39.881; most accessible tissue: Callus, score: 73.536 | N | N | N | N |
| vg1120471729 | G -> A | LOC_Os11g34930-LOC_Os11g34940 | intergenic_region ; MODIFIER | silent_mutation | Average:39.881; most accessible tissue: Callus, score: 73.536 | N | N | N | N |
| vg1120471729 | G -> DEL | N | N | silent_mutation | Average:39.881; most accessible tissue: Callus, score: 73.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120471729 | NA | 5.71E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | 5.50E-06 | 5.50E-06 | mr1193_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 8.70E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 2.89E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 3.22E-06 | mr1428_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 3.49E-07 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 5.07E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | 1.14E-06 | 1.19E-07 | mr1577_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | 8.06E-06 | 8.06E-06 | mr1587_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 2.76E-07 | mr1723_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 5.92E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 3.06E-08 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 1.41E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 4.47E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120471729 | NA | 7.39E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |