\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119892699:

Variant ID: vg1119892699 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19892699
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATTCATTCTTTTACGACAGAGCCATATATAACTATATAGCTACTATGTTACTCCTCTCTCTCAAATTATAATAAGACGCTTTAAATTTTTTAAGTCA[T/A]
TTTTTTTAGTTTGATCAGCTTATAGAGAACATAGCAAAATTTTTAACACAAAATAAATATTCTGTCCAAATTTATTCAATATAATGTTACATTTAATAAA

Reverse complement sequence

TTTATTAAATGTAACATTATATTGAATAAATTTGGACAGAATATTTATTTTGTGTTAAAAATTTTGCTATGTTCTCTATAAGCTGATCAAACTAAAAAAA[A/T]
TGACTTAAAAAATTTAAAGCGTCTTATTATAATTTGAGAGAGAGGAGTAACATAGTAGCTATATAGTTATATATGGCTCTGTCGTAAAAGAATGAATTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 23.20% 1.21% 0.00% NA
All Indica  2759 91.10% 8.40% 0.47% 0.00% NA
All Japonica  1512 53.40% 44.30% 2.31% 0.00% NA
Aus  269 44.20% 54.60% 1.12% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 84.00% 15.60% 0.44% 0.00% NA
Indica Intermediate  786 88.50% 10.30% 1.15% 0.00% NA
Temperate Japonica  767 81.70% 15.30% 3.00% 0.00% NA
Tropical Japonica  504 21.00% 77.00% 1.98% 0.00% NA
Japonica Intermediate  241 30.70% 68.50% 0.83% 0.00% NA
VI/Aromatic  96 65.60% 31.20% 3.12% 0.00% NA
Intermediate  90 78.90% 17.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119892699 T -> A LOC_Os11g34040.1 upstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:38.877; most accessible tissue: Callus, score: 63.708 N N N N
vg1119892699 T -> A LOC_Os11g34020-LOC_Os11g34040 intergenic_region ; MODIFIER silent_mutation Average:38.877; most accessible tissue: Callus, score: 63.708 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119892699 NA 2.17E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 4.76E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 8.10E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 3.18E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 5.14E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 2.32E-06 2.84E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 2.05E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 1.67E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 7.20E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 1.71E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 3.70E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 2.90E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 8.52E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 8.13E-14 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 8.54E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 2.32E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 3.74E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 1.98E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 4.81E-11 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 1.57E-07 NA mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 7.35E-06 NA mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 1.21E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119892699 NA 1.33E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251