Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119868109:

Variant ID: vg1119868109 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19868109
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATTTGCACAACACGCACAATTTAGTAGTTTTGAGAACATGCTCAAGATAAATGAGGGAGCCAATCTGATAAACACTTTACAACTCAACCTTAAATTT[A/G,T]
TTACTTATGTACTTAAAAAATACGTACAAATCAAAAGCGTAGATTGAGTCGTTAACGGCTAAAATTCAAACCGTGTTTAGCGAGAAAAAACATGCAACTT

Reverse complement sequence

AAGTTGCATGTTTTTTCTCGCTAAACACGGTTTGAATTTTAGCCGTTAACGACTCAATCTACGCTTTTGATTTGTACGTATTTTTTAAGTACATAAGTAA[T/C,A]
AAATTTAAGGTTGAGTTGTAAAGTGTTTATCAGATTGGCTCCCTCATTTATCTTGAGCATGTTCTCAAAACTACTAAATTGTGCGTGTTGTGCAAATACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.50%	28.70%	24.02%	11.74%	T: 0.08%
All Indica	2759	51.60%	9.50%	31.24%	7.68%	NA
All Japonica	1512	8.20%	54.80%	14.55%	22.22%	T: 0.26%
Aus	269	40.50%	48.30%	10.78%	0.37%	NA
Indica I	595	26.90%	20.00%	39.33%	13.78%	NA
Indica II	465	56.10%	3.70%	34.41%	5.81%	NA
Indica III	913	68.20%	4.70%	23.33%	3.72%	NA
Indica Intermediate	786	48.20%	10.60%	32.44%	8.78%	NA
Temperate Japonica	767	5.90%	80.10%	6.26%	7.30%	T: 0.52%
Tropical Japonica	504	12.50%	27.20%	22.82%	37.50%	NA
Japonica Intermediate	241	6.60%	32.00%	23.65%	37.76%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	23.30%	43.30%	26.67%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119868109	A -> T	LOC_Os11g34000.1	upstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> T	LOC_Os11g33990.1	downstream_gene_variant ; 2214.0bp to feature; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> T	LOC_Os11g33970.1	intron_variant ; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> DEL	N	N	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> G	LOC_Os11g34000.1	upstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> G	LOC_Os11g33990.1	downstream_gene_variant ; 2214.0bp to feature; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N
vg1119868109	A -> G	LOC_Os11g33970.1	intron_variant ; MODIFIER	silent_mutation	Average:6.318; most accessible tissue: Callus, score: 11.361	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119868109	NA	1.37E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	1.79E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	8.88E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	3.40E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	5.06E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	2.44E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	1.14E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	7.74E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	8.34E-06	mr1788	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	5.47E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	3.10E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	9.37E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	4.10E-10	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	4.93E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119868109	NA	3.92E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251