Variant ID: vg1119868109 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 19868109 |
Reference Allele: A | Alternative Allele: G,T |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 76. )
TGTATTTGCACAACACGCACAATTTAGTAGTTTTGAGAACATGCTCAAGATAAATGAGGGAGCCAATCTGATAAACACTTTACAACTCAACCTTAAATTT[A/G,T]
TTACTTATGTACTTAAAAAATACGTACAAATCAAAAGCGTAGATTGAGTCGTTAACGGCTAAAATTCAAACCGTGTTTAGCGAGAAAAAACATGCAACTT
AAGTTGCATGTTTTTTCTCGCTAAACACGGTTTGAATTTTAGCCGTTAACGACTCAATCTACGCTTTTGATTTGTACGTATTTTTTAAGTACATAAGTAA[T/C,A]
AAATTTAAGGTTGAGTTGTAAAGTGTTTATCAGATTGGCTCCCTCATTTATCTTGAGCATGTTCTCAAAACTACTAAATTGTGCGTGTTGTGCAAATACA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 35.50% | 28.70% | 24.02% | 11.74% | T: 0.08% |
All Indica | 2759 | 51.60% | 9.50% | 31.24% | 7.68% | NA |
All Japonica | 1512 | 8.20% | 54.80% | 14.55% | 22.22% | T: 0.26% |
Aus | 269 | 40.50% | 48.30% | 10.78% | 0.37% | NA |
Indica I | 595 | 26.90% | 20.00% | 39.33% | 13.78% | NA |
Indica II | 465 | 56.10% | 3.70% | 34.41% | 5.81% | NA |
Indica III | 913 | 68.20% | 4.70% | 23.33% | 3.72% | NA |
Indica Intermediate | 786 | 48.20% | 10.60% | 32.44% | 8.78% | NA |
Temperate Japonica | 767 | 5.90% | 80.10% | 6.26% | 7.30% | T: 0.52% |
Tropical Japonica | 504 | 12.50% | 27.20% | 22.82% | 37.50% | NA |
Japonica Intermediate | 241 | 6.60% | 32.00% | 23.65% | 37.76% | NA |
VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 23.30% | 43.30% | 26.67% | 6.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1119868109 | A -> T | LOC_Os11g34000.1 | upstream_gene_variant ; 4024.0bp to feature; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> T | LOC_Os11g33990.1 | downstream_gene_variant ; 2214.0bp to feature; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> T | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> DEL | N | N | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> G | LOC_Os11g34000.1 | upstream_gene_variant ; 4024.0bp to feature; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> G | LOC_Os11g33990.1 | downstream_gene_variant ; 2214.0bp to feature; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
vg1119868109 | A -> G | LOC_Os11g33970.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.318; most accessible tissue: Callus, score: 11.361 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1119868109 | NA | 1.37E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 1.79E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 8.88E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 3.40E-10 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 5.06E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 2.44E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 1.14E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 7.74E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 8.34E-06 | mr1788 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 5.47E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 3.10E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 9.37E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 4.10E-10 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 4.93E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1119868109 | NA | 3.92E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |