\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119756834:

Variant ID: vg1119756834 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19756834
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATGACGGCGAGCGATTTCCTGGGGAGATATCGATGGTGCGACCACAGCGGCACTCGATTTATCGGGTGCCAGAGTACATCAAGGACATGACCAACCGG[G/A]
ACGCGTATCGGCCGCAGGTGGTGTCGCTGGGGCCCTTCCACTACGGCGAACCCCCGTTGAAGCCCATGGAGGCGCACAAGCAGCGCGCGGTGGCGCACAT

Reverse complement sequence

ATGTGCGCCACCGCGCGCTGCTTGTGCGCCTCCATGGGCTTCAACGGGGGTTCGCCGTAGTGGAAGGGCCCCAGCGACACCACCTGCGGCCGATACGCGT[C/T]
CCGGTTGGTCATGTCCTTGATGTACTCTGGCACCCGATAAATCGAGTGCCGCTGTGGTCGCACCATCGATATCTCCCCAGGAAATCGCTCGCCGTCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 12.00% 1.48% 19.45% NA
All Indica  2759 87.40% 2.10% 0.33% 10.18% NA
All Japonica  1512 30.30% 28.70% 1.92% 39.09% NA
Aus  269 75.80% 0.40% 11.90% 11.90% NA
Indica I  595 98.80% 0.20% 0.00% 1.01% NA
Indica II  465 95.90% 0.90% 0.00% 3.23% NA
Indica III  913 76.80% 2.70% 0.55% 19.93% NA
Indica Intermediate  786 86.00% 3.60% 0.51% 9.92% NA
Temperate Japonica  767 44.90% 40.40% 2.74% 11.99% NA
Tropical Japonica  504 10.30% 18.30% 0.99% 70.44% NA
Japonica Intermediate  241 25.70% 13.30% 1.24% 59.75% NA
VI/Aromatic  96 32.30% 58.30% 0.00% 9.38% NA
Intermediate  90 74.40% 18.90% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119756834 G -> A LOC_Os11g33394.1 missense_variant ; p.Asp73Asn; MODERATE nonsynonymous_codon ; D73N Average:87.218; most accessible tissue: Minghui63 flag leaf, score: 96.084 benign 0.319 TOLERATED 0.55
vg1119756834 G -> A LOC_Os11g33394.2 missense_variant ; p.Asp73Asn; MODERATE nonsynonymous_codon ; D73N Average:87.218; most accessible tissue: Minghui63 flag leaf, score: 96.084 benign 0.319 TOLERATED 0.55
vg1119756834 G -> DEL LOC_Os11g33394.2 N frameshift_variant Average:87.218; most accessible tissue: Minghui63 flag leaf, score: 96.084 N N N N
vg1119756834 G -> DEL LOC_Os11g33394.1 N frameshift_variant Average:87.218; most accessible tissue: Minghui63 flag leaf, score: 96.084 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119756834 G A -0.04 -0.02 -0.02 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119756834 9.55E-06 9.55E-06 mr1038 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756834 NA 1.11E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756834 1.49E-06 NA mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119756834 2.60E-07 2.60E-07 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251