\
| Variant ID: vg1119461292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19461292 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGCTTCCGCTTGCGTTAAAATATTTTCCATGTGCGTCGAAAAAAAATTATGTATATCGTTGCTCAGAAATCCATGCACATGTTATCGCATGGGTCATT[T/C]
GGGGATGACTAGGGATCGGTCGCCCGATCCAAATCTTTAAAAATCGGCATGACGTCAACGCCGATTTACGTGTAAAACAAATTCAAACTGATTTTTCTCT
AGAGAAAAATCAGTTTGAATTTGTTTTACACGTAAATCGGCGTTGACGTCATGCCGATTTTTAAAGATTTGGATCGGGCGACCGATCCCTAGTCATCCCC[A/G]
AATGACCCATGCGATAACATGTGCATGGATTTCTGAGCAACGATATACATAATTTTTTTTCGACGCACATGGAAAATATTTTAACGCAAGCGGAAGCGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 31.90% | 0.00% | 8.74% | NA |
| All Indica | 2759 | 90.20% | 1.20% | 0.00% | 8.59% | NA |
| All Japonica | 1512 | 6.10% | 90.70% | 0.00% | 3.17% | NA |
| Aus | 269 | 56.50% | 1.50% | 0.00% | 42.01% | NA |
| Indica I | 595 | 92.30% | 1.70% | 0.00% | 6.05% | NA |
| Indica II | 465 | 77.00% | 0.60% | 0.00% | 22.37% | NA |
| Indica III | 913 | 96.50% | 0.40% | 0.00% | 3.07% | NA |
| Indica Intermediate | 786 | 89.10% | 2.20% | 0.00% | 8.78% | NA |
| Temperate Japonica | 767 | 3.70% | 94.00% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 10.90% | 87.70% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 3.70% | 86.70% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 35.60% | 0.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119461292 | T -> DEL | N | N | silent_mutation | Average:38.766; most accessible tissue: Callus, score: 93.081 | N | N | N | N |
| vg1119461292 | T -> C | LOC_Os11g32940-LOC_Os11g32950 | intergenic_region ; MODIFIER | silent_mutation | Average:38.766; most accessible tissue: Callus, score: 93.081 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119461292 | NA | 6.68E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 1.82E-19 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 3.76E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 4.13E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 7.01E-06 | mr1231 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 3.25E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 3.25E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 2.77E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 2.19E-37 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 3.36E-08 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 1.44E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 1.01E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 5.14E-20 | mr1767 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 2.06E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 2.14E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 9.12E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 1.43E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119461292 | NA | 5.84E-23 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |