\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119430301:

Variant ID: vg1119430301 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19430301
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGAAATTATTTTTTGAGATGCTAACTTGGTAGTTATTTTTGGAAGTAAAGTAAGGCCTTTGATGCCATTTTCCACCTTACCAAACTTTGATAAAATT[G/A]
TAAAAAAGTGACTCCATTTAGTTTCCTACCAAATTTAAGTAACTATACCAAAATTTTAAAATGCTAAAATTTGATAATTTTTTTTTTCATCAAAGCTGGA

Reverse complement sequence

TCCAGCTTTGATGAAAAAAAAAATTATCAAATTTTAGCATTTTAAAATTTTGGTATAGTTACTTAAATTTGGTAGGAAACTAAATGGAGTCACTTTTTTA[C/T]
AATTTTATCAAAGTTTGGTAAGGTGGAAAATGGCATCAAAGGCCTTACTTTACTTCCAAAAATAACTACCAAGTTAGCATCTCAAAAAATAATTTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 5.00% 4.76% 32.99% NA
All Indica  2759 32.10% 7.60% 6.42% 53.86% NA
All Japonica  1512 98.30% 0.20% 0.26% 1.19% NA
Aus  269 69.90% 5.60% 15.61% 8.92% NA
Indica I  595 34.60% 6.60% 3.53% 55.29% NA
Indica II  465 30.80% 9.00% 7.74% 52.47% NA
Indica III  913 29.70% 7.20% 6.90% 56.19% NA
Indica Intermediate  786 33.70% 8.10% 7.25% 50.89% NA
Temperate Japonica  767 99.20% 0.00% 0.13% 0.65% NA
Tropical Japonica  504 97.20% 0.20% 0.40% 2.18% NA
Japonica Intermediate  241 97.90% 0.80% 0.41% 0.83% NA
VI/Aromatic  96 93.80% 2.10% 1.04% 3.12% NA
Intermediate  90 63.30% 4.40% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119430301 G -> A LOC_Os11g32880.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32900.1 upstream_gene_variant ; 3153.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32880.2 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32880.3 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32900.2 upstream_gene_variant ; 3155.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32890.1 downstream_gene_variant ; 34.0bp to feature; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> A LOC_Os11g32880-LOC_Os11g32890 intergenic_region ; MODIFIER silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N
vg1119430301 G -> DEL N N silent_mutation Average:71.101; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119430301 G A 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119430301 NA 5.28E-06 mr1405_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251