Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1119406219:

Variant ID: vg1119406219 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19406219
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTTATTCAGGGAGCGATTTATACTAGAGCAGAAGATATGAAGGAGGCGGTAAAACATTTTGCAGTGTCACTTCATAGAGAGTTTTGGGTTGCCAAGT[T/C]
CAACCGGTCGCAATATGAAGTTCGGTGTGCTAAGGAAAAAGATGGTTGTCCCTGGAGAGTGCACGCTTATAAGGGAAAATGGAAAGATTATTGGACAGTG

Reverse complement sequence

CACTGTCCAATAATCTTTCCATTTTCCCTTATAAGCGTGCACTCTCCAGGGACAACCATCTTTTTCCTTAGCACACCGAACTTCATATTGCGACCGGTTG[A/G]
ACTTGGCAACCCAAAACTCTCTATGAAGTGACACTGCAAAATGTTTTACCGCCTCCTTCATATCTTCTGCTCTAGTATAAATCGCTCCCTGAATAACCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 36.40% 7.93% 0.00% NA
All Indica  2759 79.40% 7.30% 13.34% 0.00% NA
All Japonica  1512 8.50% 91.40% 0.07% 0.00% NA
Aus  269 93.30% 5.60% 1.12% 0.00% NA
Indica I  595 66.60% 7.60% 25.88% 0.00% NA
Indica II  465 85.80% 4.90% 9.25% 0.00% NA
Indica III  913 82.90% 8.90% 8.21% 0.00% NA
Indica Intermediate  786 81.20% 6.60% 12.21% 0.00% NA
Temperate Japonica  767 6.00% 93.90% 0.13% 0.00% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119406219 T -> C LOC_Os11g32850.1 missense_variant ; p.Phe211Ser; MODERATE nonsynonymous_codon ; F211S Average:26.405; most accessible tissue: Minghui63 panicle, score: 46.754 benign -0.378 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119406219 NA 9.19E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.19E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 2.09E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 5.50E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 9.66E-14 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 8.99E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 5.69E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.69E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.29E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 3.01E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 7.28E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.24E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.15E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.87E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.59E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 7.61E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.15E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.33E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.01E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.53E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.57E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 3.45E-07 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 4.43E-09 4.43E-09 mr1655 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.91E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.06E-07 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 7.73E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 9.51E-08 9.51E-08 mr1770 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 2.57E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.61E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.02E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.80E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 1.56E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 5.35E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 8.79E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.83E-18 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 3.57E-14 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119406219 NA 4.92E-07 mr1960 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251