\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119375381:

Variant ID: vg1119375381 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19375381
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGTGCACATACATAATCCGTTGAATTGAACGACGGAATGCTGTCCCGAACGACGACACCTCACACTCGGTAACACACGACACCACCTAGAAGTTGTC[A/G]
TCTATCTGACTAACATAGTCATTGATCTATGAATATATTAATACACTCGTCATCGCCGATCTTATGGATCAGCACGTTTGGGACACTGTTGGTTGTGACT

Reverse complement sequence

AGTCACAACCAACAGTGTCCCAAACGTGCTGATCCATAAGATCGGCGATGACGAGTGTATTAATATATTCATAGATCAATGACTATGTTAGTCAGATAGA[T/C]
GACAACTTCTAGGTGGTGTCGTGTGTTACCGAGTGTGAGGTGTCGTCGTTCGGGACAGCATTCCGTCGTTCAATTCAACGGATTATGTATGTGCACCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 31.70% 0.13% 3.26% NA
All Indica  2759 95.40% 1.00% 0.22% 3.37% NA
All Japonica  1512 8.10% 90.70% 0.00% 1.26% NA
Aus  269 83.30% 1.10% 0.00% 15.61% NA
Indica I  595 97.10% 1.20% 0.17% 1.51% NA
Indica II  465 91.80% 0.60% 0.43% 7.10% NA
Indica III  913 98.60% 0.30% 0.00% 1.10% NA
Indica Intermediate  786 92.50% 1.90% 0.38% 5.22% NA
Temperate Japonica  767 3.90% 93.60% 0.00% 2.48% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119375381 A -> DEL N N silent_mutation Average:37.988; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1119375381 A -> G LOC_Os11g32790.1 upstream_gene_variant ; 4769.0bp to feature; MODIFIER silent_mutation Average:37.988; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1119375381 A -> G LOC_Os11g32800.1 downstream_gene_variant ; 107.0bp to feature; MODIFIER silent_mutation Average:37.988; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1119375381 A -> G LOC_Os11g32790-LOC_Os11g32800 intergenic_region ; MODIFIER silent_mutation Average:37.988; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119375381 A G -0.07 -0.02 -0.01 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119375381 NA 1.88E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 1.88E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 7.48E-06 7.48E-06 mr1655 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 3.63E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 1.34E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 2.09E-06 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 1.51E-07 1.51E-07 mr1770 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 4.53E-06 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 4.18E-07 NA mr1829 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 5.50E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 NA 8.10E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 7.05E-06 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119375381 7.90E-06 NA mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251