\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119288479:

Variant ID: vg1119288479 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19288479
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGAGATGGAGAGCCTGCACCGGTGTATCGTGAGTACAACCCACCCCCTCTTTGTTGGGCTGCATGTAGTTGCATTTAGGTGGTAAAGTTTGGTTTATC[G/A]
ACGATGTGCGCAATGTTTTTGCCGAAAGTATTGGAGAAAAATGTAGTGTTTAGTTGGTCCGGTTGTTGATTGGGTTGTGTTTAATTTGTGTTTGTAGGCA

Reverse complement sequence

TGCCTACAAACACAAATTAAACACAACCCAATCAACAACCGGACCAACTAAACACTACATTTTTCTCCAATACTTTCGGCAAAAACATTGCGCACATCGT[C/T]
GATAAACCAAACTTTACCACCTAAATGCAACTACATGCAGCCCAACAAAGAGGGGGTGGGTTGTACTCACGATACACCGGTGCAGGCTCTCCATCTCCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 12.70% 3.07% 0.00% NA
All Indica  2759 97.60% 1.20% 1.20% 0.00% NA
All Japonica  1512 60.30% 32.70% 7.01% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.50% 0.70% 4.87% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.60% 0.38% 0.00% NA
Temperate Japonica  767 71.60% 18.80% 9.65% 0.00% NA
Tropical Japonica  504 41.50% 55.60% 2.98% 0.00% NA
Japonica Intermediate  241 63.90% 29.00% 7.05% 0.00% NA
VI/Aromatic  96 32.30% 64.60% 3.12% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119288479 G -> A LOC_Os11g32670.1 downstream_gene_variant ; 3933.0bp to feature; MODIFIER silent_mutation Average:56.859; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1119288479 G -> A LOC_Os11g32660.1 intron_variant ; MODIFIER silent_mutation Average:56.859; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119288479 NA 2.02E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 2.22E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 2.04E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 2.95E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 9.77E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 8.87E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 5.99E-07 NA mr1730 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 1.68E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 6.63E-06 5.79E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 1.97E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 NA 2.65E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479 8.73E-06 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251