Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119288479:

Variant ID: vg1119288479 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19288479
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGAGATGGAGAGCCTGCACCGGTGTATCGTGAGTACAACCCACCCCCTCTTTGTTGGGCTGCATGTAGTTGCATTTAGGTGGTAAAGTTTGGTTTATC[G/A]
ACGATGTGCGCAATGTTTTTGCCGAAAGTATTGGAGAAAAATGTAGTGTTTAGTTGGTCCGGTTGTTGATTGGGTTGTGTTTAATTTGTGTTTGTAGGCA

Reverse complement sequence

TGCCTACAAACACAAATTAAACACAACCCAATCAACAACCGGACCAACTAAACACTACATTTTTCTCCAATACTTTCGGCAAAAACATTGCGCACATCGT[C/T]
GATAAACCAAACTTTACCACCTAAATGCAACTACATGCAGCCCAACAAAGAGGGGGTGGGTTGTACTCACGATACACCGGTGCAGGCTCTCCATCTCCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	12.70%	3.07%	0.00%	NA
All Indica	2759	97.60%	1.20%	1.20%	0.00%	NA
All Japonica	1512	60.30%	32.70%	7.01%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.50%	0.70%	4.87%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.60%	0.38%	0.00%	NA
Temperate Japonica	767	71.60%	18.80%	9.65%	0.00%	NA
Tropical Japonica	504	41.50%	55.60%	2.98%	0.00%	NA
Japonica Intermediate	241	63.90%	29.00%	7.05%	0.00%	NA
VI/Aromatic	96	32.30%	64.60%	3.12%	0.00%	NA
Intermediate	90	82.20%	14.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119288479	G -> A	LOC_Os11g32670.1	downstream_gene_variant ; 3933.0bp to feature; MODIFIER	silent_mutation	Average:56.859; most accessible tissue: Zhenshan97 young leaf, score: 81.353	N	N	N	N
vg1119288479	G -> A	LOC_Os11g32660.1	intron_variant ; MODIFIER	silent_mutation	Average:56.859; most accessible tissue: Zhenshan97 young leaf, score: 81.353	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119288479	NA	2.02E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	2.22E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	2.04E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	2.95E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	9.77E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	8.87E-08	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	5.99E-07	NA	mr1730	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	1.68E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	6.63E-06	5.79E-13	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	1.97E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	NA	2.65E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119288479	8.73E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251