Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118381722:

Variant ID: vg1118381722 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 18381722
Reference Allele: T	Alternative Allele: C,TC,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGCTGTGTTTGCTGGCCATGGTGGGGAACCTTACCCTCCCACACGGAAAACGGAATGATCCGTTAGCGCATGATTAATTAAGTATTAGCTATTTTTTT[T/C,TC,A]
AAAAATGGATTAATTTGATTTTTTTAAGCAATTTTCGTATAGAAATTTTTTTTACAAAAAAACATACTATTTAGCAGTTTCAAAAGCGTACATGCGGAAA

Reverse complement sequence

TTTCCGCATGTACGCTTTTGAAACTGCTAAATAGTATGTTTTTTTGTAAAAAAAATTTCTATACGAAAATTGCTTAAAAAAATCAAATTAATCCATTTTT[A/G,GA,T]
AAAAAAATAGCTAATACTTAATTAATCATGCGCTAACGGATCATTCCGTTTTCCGTGTGGGAGGGTAAGGTTCCCCACCATGGCCAGCAAACACAGCCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.90%	22.60%	0.99%	30.22%	TC: 1.04%; A: 0.23%
All Indica	2759	41.20%	8.70%	1.20%	47.44%	TC: 1.41%
All Japonica	1512	44.10%	52.30%	0.53%	1.79%	TC: 0.66%; A: 0.60%
Aus	269	97.40%	0.00%	0.00%	2.60%	NA
Indica I	595	58.50%	19.50%	0.50%	20.17%	TC: 1.34%
Indica II	465	39.40%	7.30%	2.58%	50.75%	NA
Indica III	913	33.40%	1.80%	0.66%	62.98%	TC: 1.20%
Indica Intermediate	786	38.30%	9.50%	1.53%	48.09%	TC: 2.54%
Temperate Japonica	767	8.70%	88.10%	0.78%	1.04%	A: 1.17%; TC: 0.13%
Tropical Japonica	504	93.70%	3.20%	0.20%	1.59%	TC: 1.39%
Japonica Intermediate	241	53.10%	41.10%	0.41%	4.56%	TC: 0.83%
VI/Aromatic	96	9.40%	22.90%	4.17%	61.46%	A: 2.08%
Intermediate	90	53.30%	15.60%	2.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118381722	T -> TC	LOC_Os11g31450.1	upstream_gene_variant ; 2872.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31460.1	upstream_gene_variant ; 359.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31470.1	upstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31470.2	upstream_gene_variant ; 296.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31470.4	upstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31470.3	upstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> TC	LOC_Os11g31460-LOC_Os11g31470	intergenic_region ; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31450.1	upstream_gene_variant ; 2871.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31460.1	upstream_gene_variant ; 358.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31470.1	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31470.2	upstream_gene_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31470.4	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31470.3	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> A	LOC_Os11g31460-LOC_Os11g31470	intergenic_region ; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> DEL	N	N	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31450.1	upstream_gene_variant ; 2871.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31460.1	upstream_gene_variant ; 358.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31470.1	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31470.2	upstream_gene_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31470.4	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31470.3	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N
vg1118381722	T -> C	LOC_Os11g31460-LOC_Os11g31470	intergenic_region ; MODIFIER	silent_mutation	Average:84.367; most accessible tissue: Callus, score: 94.963	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1118381722	T	A	0.0	0.01	0.01	0.0	0.0	0.0
vg1118381722	T	C	-0.03	-0.04	-0.03	-0.03	-0.03	-0.03
vg1118381722	T	TC	-0.19	-0.14	-0.07	-0.16	-0.1	-0.1

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118381722	NA	3.76E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	5.88E-20	mr1115	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.86E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	8.30E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.22E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	5.40E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	9.27E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	7.64E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.26E-15	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	4.95E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.80E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	4.46E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.04E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.65E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.14E-12	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.08E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	3.79E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	6.06E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.49E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.77E-16	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.92E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.55E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.98E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	9.94E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.02E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	6.80E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	3.42E-12	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.07E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.34E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	5.12E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	3.84E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	1.19E-12	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722	NA	2.89E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251