\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118381722:

Variant ID: vg1118381722 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 18381722
Reference Allele: TAlternative Allele: C,TC,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGCTGTGTTTGCTGGCCATGGTGGGGAACCTTACCCTCCCACACGGAAAACGGAATGATCCGTTAGCGCATGATTAATTAAGTATTAGCTATTTTTTT[T/C,TC,A]
AAAAATGGATTAATTTGATTTTTTTAAGCAATTTTCGTATAGAAATTTTTTTTACAAAAAAACATACTATTTAGCAGTTTCAAAAGCGTACATGCGGAAA

Reverse complement sequence

TTTCCGCATGTACGCTTTTGAAACTGCTAAATAGTATGTTTTTTTGTAAAAAAAATTTCTATACGAAAATTGCTTAAAAAAATCAAATTAATCCATTTTT[A/G,GA,T]
AAAAAAATAGCTAATACTTAATTAATCATGCGCTAACGGATCATTCCGTTTTCCGTGTGGGAGGGTAAGGTTCCCCACCATGGCCAGCAAACACAGCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.90% 22.60% 0.99% 30.22% TC: 1.04%; A: 0.23%
All Indica  2759 41.20% 8.70% 1.20% 47.44% TC: 1.41%
All Japonica  1512 44.10% 52.30% 0.53% 1.79% TC: 0.66%; A: 0.60%
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 58.50% 19.50% 0.50% 20.17% TC: 1.34%
Indica II  465 39.40% 7.30% 2.58% 50.75% NA
Indica III  913 33.40% 1.80% 0.66% 62.98% TC: 1.20%
Indica Intermediate  786 38.30% 9.50% 1.53% 48.09% TC: 2.54%
Temperate Japonica  767 8.70% 88.10% 0.78% 1.04% A: 1.17%; TC: 0.13%
Tropical Japonica  504 93.70% 3.20% 0.20% 1.59% TC: 1.39%
Japonica Intermediate  241 53.10% 41.10% 0.41% 4.56% TC: 0.83%
VI/Aromatic  96 9.40% 22.90% 4.17% 61.46% A: 2.08%
Intermediate  90 53.30% 15.60% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118381722 T -> TC LOC_Os11g31450.1 upstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31460.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31470.1 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31470.2 upstream_gene_variant ; 296.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31470.4 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31470.3 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> TC LOC_Os11g31460-LOC_Os11g31470 intergenic_region ; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31450.1 upstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31460.1 upstream_gene_variant ; 358.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31470.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31470.2 upstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31470.4 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31470.3 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> A LOC_Os11g31460-LOC_Os11g31470 intergenic_region ; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> DEL N N silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31450.1 upstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31460.1 upstream_gene_variant ; 358.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31470.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31470.2 upstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31470.4 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31470.3 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N
vg1118381722 T -> C LOC_Os11g31460-LOC_Os11g31470 intergenic_region ; MODIFIER silent_mutation Average:84.367; most accessible tissue: Callus, score: 94.963 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118381722 T A 0.0 0.01 0.01 0.0 0.0 0.0
vg1118381722 T C -0.03 -0.04 -0.03 -0.03 -0.03 -0.03
vg1118381722 T TC -0.19 -0.14 -0.07 -0.16 -0.1 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118381722 NA 3.76E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 5.88E-20 mr1115 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.86E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 8.30E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.22E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 5.40E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 9.27E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 7.64E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.26E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 4.95E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.80E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 4.46E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.04E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.65E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.14E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.08E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 3.79E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 6.06E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.49E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.77E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.92E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.55E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.98E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 9.94E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.02E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 6.80E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 3.42E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.07E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.34E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 5.12E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 3.84E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 1.19E-12 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118381722 NA 2.89E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251