\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118089667:

Variant ID: vg1118089667 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18089667
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCCTCCATCGCGAGGCCAAGCTCCGCAGCCCACCGCCGATCTCCAGCCGTGCGCCGCCGACACCCTAGGTACTGCCCACCACCAAACATGTCTTCGC[C/T]
GCTCCGCCTTGCACCCCGGCCACCTTTTCACCCCTCCAATCAACTACCGAGACATCATCTTTACCGGCAACCCGAGCCACCGCCGCCATTGCAACCATCC

Reverse complement sequence

GGATGGTTGCAATGGCGGCGGTGGCTCGGGTTGCCGGTAAAGATGATGTCTCGGTAGTTGATTGGAGGGGTGAAAAGGTGGCCGGGGTGCAAGGCGGAGC[G/A]
GCGAAGACATGTTTGGTGGTGGGCAGTACCTAGGGTGTCGGCGGCGCACGGCTGGAGATCGGCGGTGGGCTGCGGAGCTTGGCCTCGCGATGGAGGCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 1.30% 0.91% 64.01% NA
All Indica  2759 14.80% 2.00% 1.20% 82.09% NA
All Japonica  1512 71.00% 0.30% 0.66% 27.98% NA
Aus  269 17.80% 0.00% 0.00% 82.16% NA
Indica I  595 25.90% 0.70% 0.50% 72.94% NA
Indica II  465 25.80% 4.70% 2.37% 67.10% NA
Indica III  913 2.40% 1.20% 0.99% 95.40% NA
Indica Intermediate  786 14.10% 2.20% 1.27% 82.44% NA
Temperate Japonica  767 95.70% 0.70% 0.00% 3.65% NA
Tropical Japonica  504 49.00% 0.00% 1.19% 49.80% NA
Japonica Intermediate  241 38.60% 0.00% 1.66% 59.75% NA
VI/Aromatic  96 32.30% 0.00% 0.00% 67.71% NA
Intermediate  90 42.20% 1.10% 0.00% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118089667 C -> T LOC_Os11g31080.1 missense_variant ; p.Arg59Gln; MODERATE nonsynonymous_codon ; R59Q Average:44.062; most accessible tissue: Minghui63 young leaf, score: 83.419 unknown unknown DELETERIOUS 0.00
vg1118089667 C -> DEL LOC_Os11g31080.1 N frameshift_variant Average:44.062; most accessible tissue: Minghui63 young leaf, score: 83.419 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118089667 C T -0.01 -0.01 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118089667 NA 1.90E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118089667 NA 3.38E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118089667 NA 2.47E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118089667 NA 9.10E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118089667 9.07E-07 9.32E-07 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251