\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118022065:

Variant ID: vg1118022065 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18022065
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGTTTCGCCCCCTGGCCTTTTTCGCTGATCAGGCGTTTGCCTTGGGGTTTTTCCACAAATTATCAATCACACGAAAAGAAATAAAAAGAAGGCGGAGGA[G/C]
ACAGAGATTTTATACTGGTTCAGGCCTCCATGGTGGATAATAGCCCTACATCCAGTTTTTTTTTCTTTTTCTCTTCTCTTTGTTGCTCTTTTTTTTTCTT

Reverse complement sequence

AAGAAAAAAAAAGAGCAACAAAGAGAAGAGAAAAAGAAAAAAAAACTGGATGTAGGGCTATTATCCACCATGGAGGCCTGAACCAGTATAAAATCTCTGT[C/G]
TCCTCCGCCTTCTTTTTATTTCTTTTCGTGTGATTGATAATTTGTGGAAAAACCCCAAGGCAAACGCCTGATCAGCGAAAAAGGCCAGGGGGCGAAACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 0.10% 3.07% 13.20% NA
All Indica  2759 86.20% 0.20% 3.88% 9.71% NA
All Japonica  1512 76.80% 0.00% 0.73% 22.49% NA
Aus  269 94.80% 0.00% 4.46% 0.74% NA
Indica I  595 73.80% 0.00% 4.54% 21.68% NA
Indica II  465 91.60% 0.00% 3.01% 5.38% NA
Indica III  913 91.80% 0.30% 4.38% 3.50% NA
Indica Intermediate  786 86.00% 0.30% 3.31% 10.43% NA
Temperate Japonica  767 95.30% 0.00% 0.39% 4.30% NA
Tropical Japonica  504 61.50% 0.00% 1.19% 37.30% NA
Japonica Intermediate  241 49.80% 0.00% 0.83% 49.38% NA
VI/Aromatic  96 80.20% 0.00% 13.54% 6.25% NA
Intermediate  90 88.90% 0.00% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118022065 G -> DEL N N silent_mutation Average:11.019; most accessible tissue: Callus, score: 24.194 N N N N
vg1118022065 G -> C LOC_Os11g30970.1 downstream_gene_variant ; 1343.0bp to feature; MODIFIER silent_mutation Average:11.019; most accessible tissue: Callus, score: 24.194 N N N N
vg1118022065 G -> C LOC_Os11g30980.1 downstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:11.019; most accessible tissue: Callus, score: 24.194 N N N N
vg1118022065 G -> C LOC_Os11g30990.1 downstream_gene_variant ; 1253.0bp to feature; MODIFIER silent_mutation Average:11.019; most accessible tissue: Callus, score: 24.194 N N N N
vg1118022065 G -> C LOC_Os11g30970-LOC_Os11g30980 intergenic_region ; MODIFIER silent_mutation Average:11.019; most accessible tissue: Callus, score: 24.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118022065 6.69E-06 NA mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118022065 4.67E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118022065 3.18E-08 NA mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118022065 5.25E-06 5.25E-06 mr1778_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251