\
| Variant ID: vg1118022065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18022065 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCGTTTCGCCCCCTGGCCTTTTTCGCTGATCAGGCGTTTGCCTTGGGGTTTTTCCACAAATTATCAATCACACGAAAAGAAATAAAAAGAAGGCGGAGGA[G/C]
ACAGAGATTTTATACTGGTTCAGGCCTCCATGGTGGATAATAGCCCTACATCCAGTTTTTTTTTCTTTTTCTCTTCTCTTTGTTGCTCTTTTTTTTTCTT
AAGAAAAAAAAAGAGCAACAAAGAGAAGAGAAAAAGAAAAAAAAACTGGATGTAGGGCTATTATCCACCATGGAGGCCTGAACCAGTATAAAATCTCTGT[C/G]
TCCTCCGCCTTCTTTTTATTTCTTTTCGTGTGATTGATAATTTGTGGAAAAACCCCAAGGCAAACGCCTGATCAGCGAAAAAGGCCAGGGGGCGAAACGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 0.10% | 3.07% | 13.20% | NA |
| All Indica | 2759 | 86.20% | 0.20% | 3.88% | 9.71% | NA |
| All Japonica | 1512 | 76.80% | 0.00% | 0.73% | 22.49% | NA |
| Aus | 269 | 94.80% | 0.00% | 4.46% | 0.74% | NA |
| Indica I | 595 | 73.80% | 0.00% | 4.54% | 21.68% | NA |
| Indica II | 465 | 91.60% | 0.00% | 3.01% | 5.38% | NA |
| Indica III | 913 | 91.80% | 0.30% | 4.38% | 3.50% | NA |
| Indica Intermediate | 786 | 86.00% | 0.30% | 3.31% | 10.43% | NA |
| Temperate Japonica | 767 | 95.30% | 0.00% | 0.39% | 4.30% | NA |
| Tropical Japonica | 504 | 61.50% | 0.00% | 1.19% | 37.30% | NA |
| Japonica Intermediate | 241 | 49.80% | 0.00% | 0.83% | 49.38% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 13.54% | 6.25% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118022065 | G -> DEL | N | N | silent_mutation | Average:11.019; most accessible tissue: Callus, score: 24.194 | N | N | N | N |
| vg1118022065 | G -> C | LOC_Os11g30970.1 | downstream_gene_variant ; 1343.0bp to feature; MODIFIER | silent_mutation | Average:11.019; most accessible tissue: Callus, score: 24.194 | N | N | N | N |
| vg1118022065 | G -> C | LOC_Os11g30980.1 | downstream_gene_variant ; 284.0bp to feature; MODIFIER | silent_mutation | Average:11.019; most accessible tissue: Callus, score: 24.194 | N | N | N | N |
| vg1118022065 | G -> C | LOC_Os11g30990.1 | downstream_gene_variant ; 1253.0bp to feature; MODIFIER | silent_mutation | Average:11.019; most accessible tissue: Callus, score: 24.194 | N | N | N | N |
| vg1118022065 | G -> C | LOC_Os11g30970-LOC_Os11g30980 | intergenic_region ; MODIFIER | silent_mutation | Average:11.019; most accessible tissue: Callus, score: 24.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118022065 | 6.69E-06 | NA | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022065 | 4.67E-06 | NA | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022065 | 3.18E-08 | NA | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022065 | 5.25E-06 | 5.25E-06 | mr1778_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |