Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117964950:

Variant ID: vg1117964950 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17964950
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTTTGAACGGCCATAACTCCGGCCAGGGTGGTTAGGTCGGGTGCTTGAGTTTCTTCATTGCTAGTTGACGCCCAACGTCGGCTTGCCATCTGTGTAGAT[C/T]
GATTAGATAAGTAACTCAATTTCCTAACTAGCCCTTATGGTTTTATCCCGTTAAGGGAGTTGTTTTGATGTGAACTTTGTTTTGCAAGCATGGTGGAATA

Reverse complement sequence

TATTCCACCATGCTTGCAAAACAAAGTTCACATCAAAACAACTCCCTTAACGGGATAAAACCATAAGGGCTAGTTAGGAAATTGAGTTACTTATCTAATC[G/A]
ATCTACACAGATGGCAAGCCGACGTTGGGCGTCAACTAGCAATGAAGAAACTCAAGCACCCGACCTAACCACCCTGGCCGGAGTTATGGCCGTTCAAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	7.90%	2.05%	18.94%	NA
All Indica	2759	73.40%	4.20%	2.65%	19.79%	NA
All Japonica	1512	76.10%	3.90%	0.40%	19.64%	NA
Aus	269	26.40%	69.50%	2.60%	1.49%	NA
Indica I	595	72.30%	5.40%	1.51%	20.84%	NA
Indica II	465	88.80%	0.60%	1.51%	9.03%	NA
Indica III	913	65.10%	5.50%	4.16%	25.30%	NA
Indica Intermediate	786	74.80%	3.80%	2.42%	18.96%	NA
Temperate Japonica	767	95.70%	2.20%	0.26%	1.83%	NA
Tropical Japonica	504	59.70%	1.80%	0.60%	37.90%	NA
Japonica Intermediate	241	47.70%	13.70%	0.41%	38.17%	NA
VI/Aromatic	96	44.80%	6.20%	11.46%	37.50%	NA
Intermediate	90	82.20%	4.40%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117964950	C -> T	LOC_Os11g30850.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:54.848; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117964950	C -> T	LOC_Os11g30860.1	upstream_gene_variant ; 11.0bp to feature; MODIFIER	silent_mutation	Average:54.848; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117964950	C -> T	LOC_Os11g30860-LOC_Os11g30880	intergenic_region ; MODIFIER	silent_mutation	Average:54.848; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg1117964950	C -> DEL	N	N	silent_mutation	Average:54.848; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117964950	NA	3.49E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	2.41E-17	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	2.49E-21	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	5.30E-20	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	2.45E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	1.20E-22	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	4.49E-08	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	1.70E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	1.13E-13	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	1.09E-06	8.30E-10	mr1417	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	5.18E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	8.08E-37	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	1.89E-46	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	7.44E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	5.96E-21	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	2.80E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117964950	NA	7.43E-47	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251