\
| Variant ID: vg1117961699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17961699 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
TTCCATTCTGGGATCCTAAGGGGTTGCAGCAAACCTGCCGGTCGCTGGTGCTCAGCCTTCACCTTCTGGCATACGTCGCAAAGTGCTACGTATTCTGCTA[C/T]
GTCTCTTTTCATGTTGGGCCACCAGTATCCTTCCTTCAGATCCTGGTACATCTTCGTACTTCCGGGGTGTAGGGAATAGGCAGATTCATGGGCTTCCTTC
GAAGGAAGCCCATGAATCTGCCTATTCCCTACACCCCGGAAGTACGAAGATGTACCAGGATCTGAAGGAAGGATACTGGTGGCCCAACATGAAAAGAGAC[G/A]
TAGCAGAATACGTAGCACTTTGCGACGTATGCCAGAAGGTGAAGGCTGAGCACCAGCGACCGGCAGGTTTGCTGCAACCCCTTAGGATCCCAGAATGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.20% | 0.34% | 1.08% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 0.10% | 0.73% | 2.38% | NA |
| Aus | 269 | 48.30% | 51.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 95.60% | 0.20% | 1.19% | 2.98% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.40% | 2.07% | 7.47% | NA |
| VI/Aromatic | 96 | 78.10% | 3.10% | 3.12% | 15.62% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117961699 | C -> T | LOC_Os11g30850.1 | missense_variant ; p.Val18Ile; MODERATE | nonsynonymous_codon ; V18I | Average:60.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | benign |
-0.019 |
TOLERATED | 1.00 |
| vg1117961699 | C -> DEL | LOC_Os11g30850.1 | N | frameshift_variant | Average:60.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117961699 | 3.92E-06 | 1.92E-17 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 1.44E-07 | 6.74E-21 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 3.67E-06 | 5.86E-19 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 5.77E-06 | 3.99E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 2.62E-06 | 3.30E-22 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 4.74E-06 | 4.35E-21 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | NA | 1.76E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 4.74E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | NA | 4.79E-21 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 5.05E-07 | 1.36E-16 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 2.18E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 1.27E-07 | 4.35E-18 | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 1.10E-06 | 8.29E-17 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 1.28E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 8.82E-07 | 1.30E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | 8.29E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117961699 | NA | 2.12E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |