\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117841367:

Variant ID: vg1117841367 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17841367
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGGAAAAGAGGTAGAGGTATTTTCGCGTGCGGACCCTTAAGAGGCCCACACCCAAAAATTGATTTTCATGTGTGGGCCTTTTAATGGTCTGCACAC[A/G]
AGAATAGGCTTATTTTTGCGTGCTGACCATTAAGCGGCCCGCCAGCGAAAATCGATTTTTGCTTGCGGGCCTTTTGAGGCTCTGCACTTGAAAATGGGAG

Reverse complement sequence

CTCCCATTTTCAAGTGCAGAGCCTCAAAAGGCCCGCAAGCAAAAATCGATTTTCGCTGGCGGGCCGCTTAATGGTCAGCACGCAAAAATAAGCCTATTCT[T/C]
GTGTGCAGACCATTAAAAGGCCCACACATGAAAATCAATTTTTGGGTGTGGGCCTCTTAAGGGTCCGCACGCGAAAATACCTCTACCTCTTTTCCCTCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.20% 21.40% 5.76% 44.63% NA
All Indica  2759 12.80% 30.70% 8.26% 48.24% NA
All Japonica  1512 59.40% 3.80% 1.26% 35.58% NA
Aus  269 12.60% 13.00% 6.32% 68.03% NA
Indica I  595 24.70% 10.90% 11.43% 52.94% NA
Indica II  465 1.50% 58.90% 4.52% 35.05% NA
Indica III  913 11.90% 30.80% 7.45% 49.84% NA
Indica Intermediate  786 11.60% 28.80% 9.03% 50.64% NA
Temperate Japonica  767 92.80% 1.80% 0.13% 5.22% NA
Tropical Japonica  504 19.00% 6.90% 2.98% 71.03% NA
Japonica Intermediate  241 37.30% 3.30% 1.24% 58.09% NA
VI/Aromatic  96 33.30% 40.60% 1.04% 25.00% NA
Intermediate  90 17.80% 37.80% 7.78% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117841367 A -> DEL N N silent_mutation Average:44.649; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg1117841367 A -> G LOC_Os11g30640.1 upstream_gene_variant ; 4009.0bp to feature; MODIFIER silent_mutation Average:44.649; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg1117841367 A -> G LOC_Os11g30650.1 downstream_gene_variant ; 3660.0bp to feature; MODIFIER silent_mutation Average:44.649; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg1117841367 A -> G LOC_Os11g30640-LOC_Os11g30650 intergenic_region ; MODIFIER silent_mutation Average:44.649; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117841367 NA 1.73E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 1.41E-15 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 8.25E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 7.75E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.13E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 1.35E-06 1.35E-06 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 8.47E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 1.68E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 6.17E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.47E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.46E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 1.07E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.13E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 3.10E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 1.87E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 4.71E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 3.99E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.55E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 3.17E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 9.86E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 7.07E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 3.18E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.50E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 4.79E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 7.24E-12 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 5.30E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117841367 NA 2.88E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251