| Variant ID: vg1117608756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17608756 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTACCGGTAGCTCAAGATATTTTTTTGTTGGACCGGAGCAAATCTCCTATTAACACAACTTTGATATTCTATGGATGCTCTCAAGCTAACCAACACAATG[C/T]
GGCAGCTGATTATAGCCAATTGTATTATCAAGATTGTAGATCGTATAAAAAATTCATGTGAAGCTTGTTCGTTCCTGGTAGTTGGGAACAAATCTCATAC
GTATGAGATTTGTTCCCAACTACCAGGAACGAACAAGCTTCACATGAATTTTTTATACGATCTACAATCTTGATAATACAATTGGCTATAATCAGCTGCC[G/A]
CATTGTGTTGGTTAGCTTGAGAGCATCCATAGAATATCAAAGTTGTGTTAATAGGAGATTTGCTCCGGTCCAACAAAAAAATATCTTGAGCTACCGGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 32.20% | 0.80% | 29.43% | NA |
| All Indica | 2759 | 43.50% | 7.10% | 1.01% | 48.46% | NA |
| All Japonica | 1512 | 16.40% | 81.70% | 0.07% | 1.79% | NA |
| Aus | 269 | 84.80% | 7.10% | 2.97% | 5.20% | NA |
| Indica I | 595 | 24.40% | 10.10% | 1.68% | 63.87% | NA |
| Indica II | 465 | 53.50% | 0.90% | 1.51% | 44.09% | NA |
| Indica III | 913 | 50.60% | 8.50% | 0.44% | 40.42% | NA |
| Indica Intermediate | 786 | 43.60% | 6.70% | 0.89% | 48.73% | NA |
| Temperate Japonica | 767 | 1.70% | 97.40% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 39.50% | 56.70% | 0.20% | 3.57% | NA |
| Japonica Intermediate | 241 | 14.90% | 84.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 50.00% | 49.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 55.60% | 30.00% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117608756 | C -> T | LOC_Os11g30320.1 | upstream_gene_variant ; 3273.0bp to feature; MODIFIER | silent_mutation | Average:23.554; most accessible tissue: Callus, score: 71.79 | N | N | N | N |
| vg1117608756 | C -> T | LOC_Os11g30320-LOC_Os11g30340 | intergenic_region ; MODIFIER | silent_mutation | Average:23.554; most accessible tissue: Callus, score: 71.79 | N | N | N | N |
| vg1117608756 | C -> DEL | N | N | silent_mutation | Average:23.554; most accessible tissue: Callus, score: 71.79 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117608756 | 4.83E-06 | NA | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117608756 | NA | 1.24E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117608756 | NA | 5.22E-15 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117608756 | NA | 2.26E-08 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117608756 | NA | 2.62E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117608756 | NA | 3.53E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |