\
| Variant ID: vg1117544237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17544237 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )
AAATATAATGCATTTATTCAAACAAATTTTTTAAAAATACACACTATTTAACTCAATAGTCACATATAGGATCTACGAATATTACCTGAAATCGGCGTCT[G/A]
AATCCGGCAGGGCTTCGCCCCTTCGTCTCTTCTCCTCCCCTCTCTTCTTTTTTTTTCACCGGATTTGAGAGGTGAGGAATGAGGGCTGGGGGCTGGGCGG
CCGCCCAGCCCCCAGCCCTCATTCCTCACCTCTCAAATCCGGTGAAAAAAAAAGAAGAGAGGGGAGGAGAAGAGACGAAGGGGCGAAGCCCTGCCGGATT[C/T]
AGACGCCGATTTCAGGTAATATTCGTAGATCCTATATGTGACTATTGAGTTAAATAGTGTGTATTTTTAAAAAATTTGTTTGAATAAATGCATTATATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 5.10% | 5.08% | 32.78% | NA |
| All Indica | 2759 | 38.30% | 8.40% | 7.00% | 46.28% | NA |
| All Japonica | 1512 | 83.40% | 0.10% | 1.12% | 15.34% | NA |
| Aus | 269 | 91.10% | 0.00% | 2.23% | 6.69% | NA |
| Indica I | 595 | 19.80% | 12.60% | 3.53% | 64.03% | NA |
| Indica II | 465 | 35.50% | 13.30% | 7.10% | 44.09% | NA |
| Indica III | 913 | 49.30% | 3.90% | 9.31% | 37.46% | NA |
| Indica Intermediate | 786 | 41.30% | 7.40% | 6.87% | 44.40% | NA |
| Temperate Japonica | 767 | 97.70% | 0.10% | 0.13% | 2.09% | NA |
| Tropical Japonica | 504 | 59.50% | 0.20% | 2.78% | 37.50% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.00% | 0.83% | 11.20% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 19.79% | 2.08% | NA |
| Intermediate | 90 | 61.10% | 11.10% | 5.56% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117544237 | G -> A | LOC_Os11g30170.1 | upstream_gene_variant ; 426.0bp to feature; MODIFIER | silent_mutation | Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| vg1117544237 | G -> A | LOC_Os11g30180.1 | upstream_gene_variant ; 1177.0bp to feature; MODIFIER | silent_mutation | Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| vg1117544237 | G -> A | LOC_Os11g30190.1 | upstream_gene_variant ; 3928.0bp to feature; MODIFIER | silent_mutation | Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| vg1117544237 | G -> A | LOC_Os11g30170-LOC_Os11g30180 | intergenic_region ; MODIFIER | silent_mutation | Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| vg1117544237 | G -> DEL | N | N | silent_mutation | Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117544237 | NA | 7.31E-09 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 9.28E-07 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 3.14E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 5.31E-10 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 4.01E-07 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 4.56E-08 | mr1310_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 5.87E-11 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 3.68E-10 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 2.62E-09 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117544237 | NA | 9.66E-08 | mr1959_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |