\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117544237:

Variant ID: vg1117544237 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17544237
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATAATGCATTTATTCAAACAAATTTTTTAAAAATACACACTATTTAACTCAATAGTCACATATAGGATCTACGAATATTACCTGAAATCGGCGTCT[G/A]
AATCCGGCAGGGCTTCGCCCCTTCGTCTCTTCTCCTCCCCTCTCTTCTTTTTTTTTCACCGGATTTGAGAGGTGAGGAATGAGGGCTGGGGGCTGGGCGG

Reverse complement sequence

CCGCCCAGCCCCCAGCCCTCATTCCTCACCTCTCAAATCCGGTGAAAAAAAAAGAAGAGAGGGGAGGAGAAGAGACGAAGGGGCGAAGCCCTGCCGGATT[C/T]
AGACGCCGATTTCAGGTAATATTCGTAGATCCTATATGTGACTATTGAGTTAAATAGTGTGTATTTTTAAAAAATTTGTTTGAATAAATGCATTATATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 5.10% 5.08% 32.78% NA
All Indica  2759 38.30% 8.40% 7.00% 46.28% NA
All Japonica  1512 83.40% 0.10% 1.12% 15.34% NA
Aus  269 91.10% 0.00% 2.23% 6.69% NA
Indica I  595 19.80% 12.60% 3.53% 64.03% NA
Indica II  465 35.50% 13.30% 7.10% 44.09% NA
Indica III  913 49.30% 3.90% 9.31% 37.46% NA
Indica Intermediate  786 41.30% 7.40% 6.87% 44.40% NA
Temperate Japonica  767 97.70% 0.10% 0.13% 2.09% NA
Tropical Japonica  504 59.50% 0.20% 2.78% 37.50% NA
Japonica Intermediate  241 88.00% 0.00% 0.83% 11.20% NA
VI/Aromatic  96 78.10% 0.00% 19.79% 2.08% NA
Intermediate  90 61.10% 11.10% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117544237 G -> A LOC_Os11g30170.1 upstream_gene_variant ; 426.0bp to feature; MODIFIER silent_mutation Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1117544237 G -> A LOC_Os11g30180.1 upstream_gene_variant ; 1177.0bp to feature; MODIFIER silent_mutation Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1117544237 G -> A LOC_Os11g30190.1 upstream_gene_variant ; 3928.0bp to feature; MODIFIER silent_mutation Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1117544237 G -> A LOC_Os11g30170-LOC_Os11g30180 intergenic_region ; MODIFIER silent_mutation Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1117544237 G -> DEL N N silent_mutation Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117544237 NA 7.31E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 9.28E-07 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 3.14E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 5.31E-10 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 4.01E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 4.56E-08 mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 5.87E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 3.68E-10 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 2.62E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237 NA 9.66E-08 mr1959_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251