Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1117544237:

Variant ID: vg1117544237 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17544237
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AAATATAATGCATTTATTCAAACAAATTTTTTAAAAATACACACTATTTAACTCAATAGTCACATATAGGATCTACGAATATTACCTGAAATCGGCGTCT[G/A]
AATCCGGCAGGGCTTCGCCCCTTCGTCTCTTCTCCTCCCCTCTCTTCTTTTTTTTTCACCGGATTTGAGAGGTGAGGAATGAGGGCTGGGGGCTGGGCGG

Reverse complement sequence

CCGCCCAGCCCCCAGCCCTCATTCCTCACCTCTCAAATCCGGTGAAAAAAAAAGAAGAGAGGGGAGGAGAAGAGACGAAGGGGCGAAGCCCTGCCGGATT[C/T]
AGACGCCGATTTCAGGTAATATTCGTAGATCCTATATGTGACTATTGAGTTAAATAGTGTGTATTTTTAAAAAATTTGTTTGAATAAATGCATTATATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	5.10%	5.08%	32.78%	NA
All Indica	2759	38.30%	8.40%	7.00%	46.28%	NA
All Japonica	1512	83.40%	0.10%	1.12%	15.34%	NA
Aus	269	91.10%	0.00%	2.23%	6.69%	NA
Indica I	595	19.80%	12.60%	3.53%	64.03%	NA
Indica II	465	35.50%	13.30%	7.10%	44.09%	NA
Indica III	913	49.30%	3.90%	9.31%	37.46%	NA
Indica Intermediate	786	41.30%	7.40%	6.87%	44.40%	NA
Temperate Japonica	767	97.70%	0.10%	0.13%	2.09%	NA
Tropical Japonica	504	59.50%	0.20%	2.78%	37.50%	NA
Japonica Intermediate	241	88.00%	0.00%	0.83%	11.20%	NA
VI/Aromatic	96	78.10%	0.00%	19.79%	2.08%	NA
Intermediate	90	61.10%	11.10%	5.56%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117544237	G -> A	LOC_Os11g30170.1	upstream_gene_variant ; 426.0bp to feature; MODIFIER	silent_mutation	Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg1117544237	G -> A	LOC_Os11g30180.1	upstream_gene_variant ; 1177.0bp to feature; MODIFIER	silent_mutation	Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg1117544237	G -> A	LOC_Os11g30190.1	upstream_gene_variant ; 3928.0bp to feature; MODIFIER	silent_mutation	Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg1117544237	G -> A	LOC_Os11g30170-LOC_Os11g30180	intergenic_region ; MODIFIER	silent_mutation	Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg1117544237	G -> DEL	N	N	silent_mutation	Average:24.938; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117544237	NA	7.31E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	9.28E-07	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	3.14E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	5.31E-10	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	4.01E-07	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	4.56E-08	mr1310_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	5.87E-11	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	3.68E-10	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	2.62E-09	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117544237	NA	9.66E-08	mr1959_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251