\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117539909:

Variant ID: vg1117539909 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17539909
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGTCCACCTCCGGGCGGCCGATCGCAATCCTCTCAGCTGCCCAGATAGAAAGAAAGAGAGGGCACCCACCAAAGGTCGCGCTGGGATACGTCTTCGTG[C/T]
AAGCCTCACAAAGTCCACGGTACAGAGCCGCGAACAACGCGGAACCCCAGCTCCACTGAGGCACCTCGCCTACCGCGGCGTCGGCGATGCTCCTGGCGTA

Reverse complement sequence

TACGCCAGGAGCATCGCCGACGCCGCGGTAGGCGAGGTGCCTCAGTGGAGCTGGGGTTCCGCGTTGTTCGCGGCTCTGTACCGTGGACTTTGTGAGGCTT[G/A]
CACGAAGACGTATCCCAGCGCGACCTTTGGTGGGTGCCCTCTCTTTCTTTCTATCTGGGCAGCTGAGAGGATTGCGATCGGCCGCCCGGAGGTGGACTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 3.20% 3.53% 31.74% NA
All Indica  2759 43.80% 5.30% 4.57% 46.32% NA
All Japonica  1512 84.90% 0.10% 2.25% 12.76% NA
Aus  269 93.70% 0.00% 0.74% 5.58% NA
Indica I  595 34.30% 6.40% 2.18% 57.14% NA
Indica II  465 41.90% 8.40% 2.58% 47.10% NA
Indica III  913 48.10% 3.10% 6.57% 42.28% NA
Indica Intermediate  786 47.20% 5.20% 5.22% 42.37% NA
Temperate Japonica  767 97.90% 0.10% 0.13% 1.83% NA
Tropical Japonica  504 63.30% 0.20% 5.95% 30.56% NA
Japonica Intermediate  241 88.40% 0.00% 1.24% 10.37% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 4.40% 5.56% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117539909 C -> T LOC_Os11g30170.1 intron_variant ; MODIFIER silent_mutation Average:52.649; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg1117539909 C -> DEL N N silent_mutation Average:52.649; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117539909 NA 4.95E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 1.17E-06 mr1156 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 5.76E-06 mr1179 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 5.88E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 7.39E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 3.41E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 1.65E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 2.73E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 6.34E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 3.32E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117539909 NA 2.26E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251