Variant ID: vg1117445573 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 17445573 |
Reference Allele: T | Alternative Allele: G |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )
TTGATATGACTACTTTGACTTTGGATTCGCTTTACACAAAACTTAAAACACATGAGATGAATATTCTTGCTCGTAAAGTTGATTCTAAGTCTAGTGCTTT[T/G]
GTTTCTTCTTCGACCTCTTTGGATGTTGGTGCTTCTACATCAAAGTCTTCAATTCTTGCTTTAATTAATGCCACGTCCGAAGATCAACTCGAACAGTTCG
CGAACTGTTCGAGTTGATCTTCGGACGTGGCATTAATTAAAGCAAGAATTGAAGACTTTGATGTAGAAGCACCAACATCCAAAGAGGTCGAAGAAGAAAC[A/C]
AAAGCACTAGACTTAGAATCAACTTTACGAGCAAGAATATTCATCTCATGTGTTTTAAGTTTTGTGTAAAGCGAATCCAAAGTCAAAGTAGTCATATCAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.40% | 10.30% | 2.09% | 2.22% | NA |
All Indica | 2759 | 99.30% | 0.40% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 55.90% | 31.30% | 5.89% | 6.88% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.50% | 1.20% | 1.34% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 25.70% | 51.20% | 9.52% | 13.56% | NA |
Tropical Japonica | 504 | 96.80% | 2.40% | 0.79% | 0.00% | NA |
Japonica Intermediate | 241 | 66.40% | 28.60% | 4.98% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 2.20% | 2.22% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1117445573 | T -> DEL | LOC_Os11g30000.1 | N | frameshift_variant | Average:29.565; most accessible tissue: Zhenshan97 young leaf, score: 43.23 | N | N | N | N |
vg1117445573 | T -> G | LOC_Os11g30000.1 | missense_variant ; p.Phe232Leu; MODERATE | nonsynonymous_codon ; F232L | Average:29.565; most accessible tissue: Zhenshan97 young leaf, score: 43.23 | unknown | unknown | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1117445573 | 3.62E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1117445573 | 2.34E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | NA | 9.92E-06 | mr1882 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | NA | 8.05E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | 5.61E-06 | NA | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | 1.41E-10 | 6.97E-35 | mr1137_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | 5.38E-06 | 3.92E-11 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | 4.77E-07 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | NA | 5.15E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | 1.43E-07 | NA | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1117445573 | NA | 7.67E-08 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |