\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117422908:

Variant ID: vg1117422908 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17422908
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTATAAGCAGGTGAATCTATTATTTCTAACCATTAGATATATCTTAAGGATCTATTTCCAATAAAAGAAATCTCCTCTCTCTACATATATGTACTCCT[C/T]
CCTCTATGGTACGTACGTGAATTTCCTATTTTATAGCTAGCAACCCCATATAAAAACTTAAGTTACTAAGTTATATAATAAACCACAACGATTCAGAGAA

Reverse complement sequence

TTCTCTGAATCGTTGTGGTTTATTATATAACTTAGTAACTTAAGTTTTTATATGGGGTTGCTAGCTATAAAATAGGAAATTCACGTACGTACCATAGAGG[G/A]
AGGAGTACATATATGTAGAGAGAGGAGATTTCTTTTATTGGAAATAGATCCTTAAGATATATCTAATGGTTAGAAATAATAGATTCACCTGCTTATAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 11.70% 3.68% 0.00% NA
All Indica  2759 97.70% 1.70% 0.58% 0.00% NA
All Japonica  1512 57.70% 32.30% 9.99% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.30% 5.20% 1.51% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.20% 0.66% 0.00% NA
Indica Intermediate  786 98.00% 1.90% 0.13% 0.00% NA
Temperate Japonica  767 67.30% 30.40% 2.35% 0.00% NA
Tropical Japonica  504 53.00% 28.20% 18.85% 0.00% NA
Japonica Intermediate  241 36.90% 47.30% 15.77% 0.00% NA
VI/Aromatic  96 85.40% 11.50% 3.12% 0.00% NA
Intermediate  90 88.90% 6.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117422908 C -> T LOC_Os11g29980.1 downstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:22.919; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N
vg1117422908 C -> T LOC_Os11g29970-LOC_Os11g29980 intergenic_region ; MODIFIER silent_mutation Average:22.919; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117422908 NA 2.05E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 9.82E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 5.04E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 3.69E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 9.13E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 4.01E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 1.18E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 4.88E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 6.75E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 8.33E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 1.71E-06 1.71E-06 mr1573 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 5.50E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 1.37E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 5.39E-07 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 1.96E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 7.18E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 7.84E-06 NA mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 1.48E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 NA 2.38E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117422908 7.82E-06 NA mr1698_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251