\
| Variant ID: vg1117422908 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17422908 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTTATAAGCAGGTGAATCTATTATTTCTAACCATTAGATATATCTTAAGGATCTATTTCCAATAAAAGAAATCTCCTCTCTCTACATATATGTACTCCT[C/T]
CCTCTATGGTACGTACGTGAATTTCCTATTTTATAGCTAGCAACCCCATATAAAAACTTAAGTTACTAAGTTATATAATAAACCACAACGATTCAGAGAA
TTCTCTGAATCGTTGTGGTTTATTATATAACTTAGTAACTTAAGTTTTTATATGGGGTTGCTAGCTATAAAATAGGAAATTCACGTACGTACCATAGAGG[G/A]
AGGAGTACATATATGTAGAGAGAGGAGATTTCTTTTATTGGAAATAGATCCTTAAGATATATCTAATGGTTAGAAATAATAGATTCACCTGCTTATAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.60% | 11.70% | 3.68% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 1.70% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 57.70% | 32.30% | 9.99% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 5.20% | 1.51% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 67.30% | 30.40% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 53.00% | 28.20% | 18.85% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.90% | 47.30% | 15.77% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 11.50% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 6.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117422908 | C -> T | LOC_Os11g29980.1 | downstream_gene_variant ; 2637.0bp to feature; MODIFIER | silent_mutation | Average:22.919; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg1117422908 | C -> T | LOC_Os11g29970-LOC_Os11g29980 | intergenic_region ; MODIFIER | silent_mutation | Average:22.919; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117422908 | NA | 2.05E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 9.82E-11 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 5.04E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 3.69E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 9.13E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 4.01E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 1.18E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 4.88E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 6.75E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 8.33E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | 1.71E-06 | 1.71E-06 | mr1573 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 5.50E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 1.37E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 5.39E-07 | mr1748 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 1.96E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 7.18E-06 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | 7.84E-06 | NA | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 1.48E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | NA | 2.38E-07 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117422908 | 7.82E-06 | NA | mr1698_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |