\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117363278:

Variant ID: vg1117363278 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17363278
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGGCCAGGGGGGCGAAACGAATCGGCCGAAGCATTGCTCGCCGAACATTGAAACCGCAACAGCTTGTCTCGGAAAATAAATAGCCGAACGACGTTA[C/T]
GTCCGATCAGCATAAAAGCAAAAGTGTTTCTCTCGACACAGAACGCTACAGATCGAAGACGAACGACGAAAAGCTGAAAAGCCAGTACACCTATTTCGCT

Reverse complement sequence

AGCGAAATAGGTGTACTGGCTTTTCAGCTTTTCGTCGTTCGTCTTCGATCTGTAGCGTTCTGTGTCGAGAGAAACACTTTTGCTTTTATGCTGATCGGAC[G/A]
TAACGTCGTTCGGCTATTTATTTTCCGAGACAAGCTGTTGCGGTTTCAATGTTCGGCGAGCAATGCTTCGGCCGATTCGTTTCGCCCCCCTGGCCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 0.40% 15.70% 19.11% NA
All Indica  2759 50.10% 0.70% 22.62% 26.57% NA
All Japonica  1512 88.30% 0.10% 1.59% 10.05% NA
Aus  269 67.30% 0.00% 30.86% 1.86% NA
Indica I  595 41.50% 0.70% 21.68% 36.13% NA
Indica II  465 40.90% 0.90% 24.95% 33.33% NA
Indica III  913 58.90% 0.90% 22.56% 17.63% NA
Indica Intermediate  786 51.90% 0.40% 22.01% 25.70% NA
Temperate Japonica  767 98.80% 0.00% 0.13% 1.04% NA
Tropical Japonica  504 70.60% 0.20% 3.37% 25.79% NA
Japonica Intermediate  241 91.70% 0.00% 2.49% 5.81% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 74.40% 0.00% 12.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117363278 C -> T LOC_Os11g29880.1 downstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:10.018; most accessible tissue: Callus, score: 16.104 N N N N
vg1117363278 C -> T LOC_Os11g29890.1 downstream_gene_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:10.018; most accessible tissue: Callus, score: 16.104 N N N N
vg1117363278 C -> T LOC_Os11g29880-LOC_Os11g29890 intergenic_region ; MODIFIER silent_mutation Average:10.018; most accessible tissue: Callus, score: 16.104 N N N N
vg1117363278 C -> DEL N N silent_mutation Average:10.018; most accessible tissue: Callus, score: 16.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117363278 1.23E-06 6.93E-06 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117363278 NA 9.69E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117363278 9.92E-07 NA mr1781_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117363278 5.19E-06 5.19E-06 mr1781_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251