\
| Variant ID: vg1117363278 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17363278 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAGGCCAGGGGGGCGAAACGAATCGGCCGAAGCATTGCTCGCCGAACATTGAAACCGCAACAGCTTGTCTCGGAAAATAAATAGCCGAACGACGTTA[C/T]
GTCCGATCAGCATAAAAGCAAAAGTGTTTCTCTCGACACAGAACGCTACAGATCGAAGACGAACGACGAAAAGCTGAAAAGCCAGTACACCTATTTCGCT
AGCGAAATAGGTGTACTGGCTTTTCAGCTTTTCGTCGTTCGTCTTCGATCTGTAGCGTTCTGTGTCGAGAGAAACACTTTTGCTTTTATGCTGATCGGAC[G/A]
TAACGTCGTTCGGCTATTTATTTTCCGAGACAAGCTGTTGCGGTTTCAATGTTCGGCGAGCAATGCTTCGGCCGATTCGTTTCGCCCCCCTGGCCTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 0.40% | 15.70% | 19.11% | NA |
| All Indica | 2759 | 50.10% | 0.70% | 22.62% | 26.57% | NA |
| All Japonica | 1512 | 88.30% | 0.10% | 1.59% | 10.05% | NA |
| Aus | 269 | 67.30% | 0.00% | 30.86% | 1.86% | NA |
| Indica I | 595 | 41.50% | 0.70% | 21.68% | 36.13% | NA |
| Indica II | 465 | 40.90% | 0.90% | 24.95% | 33.33% | NA |
| Indica III | 913 | 58.90% | 0.90% | 22.56% | 17.63% | NA |
| Indica Intermediate | 786 | 51.90% | 0.40% | 22.01% | 25.70% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 70.60% | 0.20% | 3.37% | 25.79% | NA |
| Japonica Intermediate | 241 | 91.70% | 0.00% | 2.49% | 5.81% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 12.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117363278 | C -> T | LOC_Os11g29880.1 | downstream_gene_variant ; 290.0bp to feature; MODIFIER | silent_mutation | Average:10.018; most accessible tissue: Callus, score: 16.104 | N | N | N | N |
| vg1117363278 | C -> T | LOC_Os11g29890.1 | downstream_gene_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:10.018; most accessible tissue: Callus, score: 16.104 | N | N | N | N |
| vg1117363278 | C -> T | LOC_Os11g29880-LOC_Os11g29890 | intergenic_region ; MODIFIER | silent_mutation | Average:10.018; most accessible tissue: Callus, score: 16.104 | N | N | N | N |
| vg1117363278 | C -> DEL | N | N | silent_mutation | Average:10.018; most accessible tissue: Callus, score: 16.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117363278 | 1.23E-06 | 6.93E-06 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117363278 | NA | 9.69E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117363278 | 9.92E-07 | NA | mr1781_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117363278 | 5.19E-06 | 5.19E-06 | mr1781_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |