\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117143845:

Variant ID: vg1117143845 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17143845
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGAGATCAGGGCACGCCAGTTTCACGCATGCGAGGACGTGGCACGCCCTGGTATAGATCCCGTTCGACATCTCCTCGCCGATCCTGGCCGCATGCTTG[G/T]
AGGGGATCTCCTCCATTGCCGCCGCCAGCTCTGCGAGCAAGGACGTCAGCGAGAACTCGTCGGGGGTTGCCGGGATGGTGGTCGTGACGCCGCACTCCCC

Reverse complement sequence

GGGGAGTGCGGCGTCACGACCACCATCCCGGCAACCCCCGACGAGTTCTCGCTGACGTCCTTGCTCGCAGAGCTGGCGGCGGCAATGGAGGAGATCCCCT[C/A]
CAAGCATGCGGCCAGGATCGGCGAGGAGATGTCGAACGGGATCTATACCAGGGCGTGCCACGTCCTCGCATGCGTGAAACTGGCGTGCCCTGATCTCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 11.30% 2.92% 27.34% NA
All Indica  2759 60.40% 18.80% 3.30% 17.47% NA
All Japonica  1512 61.20% 0.30% 0.99% 37.43% NA
Aus  269 36.10% 0.00% 8.18% 55.76% NA
Indica I  595 88.90% 5.50% 1.34% 4.20% NA
Indica II  465 49.90% 14.60% 7.31% 28.17% NA
Indica III  913 46.40% 30.90% 3.18% 19.50% NA
Indica Intermediate  786 61.20% 17.40% 2.54% 18.83% NA
Temperate Japonica  767 87.70% 0.00% 0.13% 12.13% NA
Tropical Japonica  504 35.30% 0.80% 1.79% 62.10% NA
Japonica Intermediate  241 31.10% 0.40% 2.07% 66.39% NA
VI/Aromatic  96 13.50% 1.00% 5.21% 80.21% NA
Intermediate  90 66.70% 8.90% 5.56% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117143845 G -> T LOC_Os11g29540.1 missense_variant ; p.Ser124Tyr; MODERATE nonsynonymous_codon ; S124Y Average:61.931; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 probably damaging 2.55 DELETERIOUS 0.00
vg1117143845 G -> DEL LOC_Os11g29540.1 N frameshift_variant Average:61.931; most accessible tissue: Zhenshan97 flag leaf, score: 85.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117143845 G T -0.01 -0.01 -0.01 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117143845 NA 7.84E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 2.62E-07 mr1230 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 4.74E-06 4.74E-06 mr1230 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 7.23E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 8.55E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 2.86E-06 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 1.94E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 6.56E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 1.77E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 2.43E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 8.16E-06 8.16E-06 mr1869 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 3.36E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117143845 NA 9.67E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251