\
| Variant ID: vg1117087408 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17087408 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 96. )
TAGCCACGTCATCAAAAATAGTTTCAACCGTTAGATTGATAATTCTTTCGAGTATTAGCCGTTAGATAAAAGTCCCCTCTACTTCCTCACCAATTAAACA[A/G]
CGCCATTAATCACCACCCCATCTAAATGCTATCTAATTAATCAGGTAGTCAATTGGACAATAATACAATCAAGATATCATATCATATTTACTATTCCAAC
GTTGGAATAGTAAATATGATATGATATCTTGATTGTATTATTGTCCAATTGACTACCTGATTAATTAGATAGCATTTAGATGGGGTGGTGATTAATGGCG[T/C]
TGTTTAATTGGTGAGGAAGTAGAGGGGACTTTTATCTAACGGCTAATACTCGAAAGAATTATCAATCTAACGGTTGAAACTATTTTTGATGACGTGGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.60% | 14.20% | 5.59% | 34.68% | NA |
| All Indica | 2759 | 37.90% | 21.30% | 8.88% | 31.97% | NA |
| All Japonica | 1512 | 54.00% | 4.50% | 0.60% | 40.87% | NA |
| Aus | 269 | 87.70% | 0.70% | 0.37% | 11.15% | NA |
| Indica I | 595 | 31.10% | 8.90% | 4.87% | 55.13% | NA |
| Indica II | 465 | 52.90% | 14.00% | 16.34% | 16.77% | NA |
| Indica III | 913 | 29.80% | 34.40% | 7.23% | 28.59% | NA |
| Indica Intermediate | 786 | 43.50% | 19.70% | 9.41% | 27.35% | NA |
| Temperate Japonica | 767 | 86.20% | 0.00% | 0.26% | 13.56% | NA |
| Tropical Japonica | 504 | 19.60% | 12.70% | 0.79% | 66.87% | NA |
| Japonica Intermediate | 241 | 23.70% | 1.70% | 1.24% | 73.44% | NA |
| VI/Aromatic | 96 | 9.40% | 2.10% | 1.04% | 87.50% | NA |
| Intermediate | 90 | 51.10% | 12.20% | 8.89% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117087408 | A -> DEL | N | N | silent_mutation | Average:28.163; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1117087408 | A -> G | LOC_Os11g29430.1 | downstream_gene_variant ; 513.0bp to feature; MODIFIER | silent_mutation | Average:28.163; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1117087408 | A -> G | LOC_Os11g29440.1 | downstream_gene_variant ; 2570.0bp to feature; MODIFIER | silent_mutation | Average:28.163; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1117087408 | A -> G | LOC_Os11g29420-LOC_Os11g29430 | intergenic_region ; MODIFIER | silent_mutation | Average:28.163; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117087408 | NA | 3.64E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 1.38E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 5.01E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 3.56E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 8.56E-07 | 3.70E-09 | mr1115 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 6.50E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 1.34E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 2.52E-07 | 2.52E-07 | mr1230 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 1.10E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 7.19E-06 | 7.79E-08 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 6.59E-08 | mr1428 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 2.02E-06 | 2.02E-06 | mr1428 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 1.03E-06 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 4.02E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 1.32E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 4.72E-06 | mr1820 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 1.88E-06 | 1.88E-06 | mr1869 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 6.80E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | NA | 3.26E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117087408 | 5.65E-06 | 5.65E-06 | mr1996 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |