Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117083295:

Variant ID: vg1117083295 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17083295
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGATACCATGGTTGGAGCACCAAGGCTTATAAGCAGGCCCTCACCCACCTAAACTTCCAAGGTGGTACTAAACCACCACTACACATCCACTTCAGGGC[C/T]
ATATGGGCCAAACACCACATGGGCCAAACACACACTACTAGGCTTCAAACGGGCTGGGGTGTTACACTTGGGGAAGGACTTCACATGGTCCCAAATAAAC

Reverse complement sequence

GTTTATTTGGGACCATGTGAAGTCCTTCCCCAAGTGTAACACCCCAGCCCGTTTGAAGCCTAGTAGTGTGTGTTTGGCCCATGTGGTGTTTGGCCCATAT[G/A]
GCCCTGAAGTGGATGTGTAGTGGTGGTTTAGTACCACCTTGGAAGTTTAGGTGGGTGAGGGCCTGCTTATAAGCCTTGGTGCTCCAACCATGGTATCCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.20%	14.70%	5.50%	31.63%	NA
All Indica	2759	38.20%	22.00%	7.72%	32.15%	NA
All Japonica	1512	56.00%	4.60%	2.51%	36.90%	NA
Aus	269	93.30%	0.70%	1.12%	4.83%	NA
Indica I	595	35.60%	9.10%	10.25%	45.04%	NA
Indica II	465	43.90%	16.60%	6.45%	33.12%	NA
Indica III	913	33.70%	34.50%	5.37%	26.40%	NA
Indica Intermediate	786	41.90%	20.40%	9.29%	28.50%	NA
Temperate Japonica	767	86.70%	0.40%	0.78%	12.13%	NA
Tropical Japonica	504	22.40%	12.50%	3.97%	61.11%	NA
Japonica Intermediate	241	28.20%	1.70%	4.98%	65.15%	NA
VI/Aromatic	96	77.10%	2.10%	4.17%	16.67%	NA
Intermediate	90	60.00%	14.40%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117083295	C -> T	LOC_Os11g29410.1	upstream_gene_variant ; 4204.0bp to feature; MODIFIER	silent_mutation	Average:37.484; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1117083295	C -> T	LOC_Os11g29420.1	upstream_gene_variant ; 1904.0bp to feature; MODIFIER	silent_mutation	Average:37.484; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1117083295	C -> T	LOC_Os11g29430.1	downstream_gene_variant ; 4626.0bp to feature; MODIFIER	silent_mutation	Average:37.484; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1117083295	C -> T	LOC_Os11g29420-LOC_Os11g29430	intergenic_region ; MODIFIER	silent_mutation	Average:37.484; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1117083295	C -> DEL	N	N	silent_mutation	Average:37.484; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117083295	NA	4.04E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	8.92E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	3.41E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	5.62E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	2.25E-06	6.87E-09	mr1115	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	3.28E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	2.65E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	7.86E-07	7.86E-07	mr1230	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	4.59E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	3.17E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	8.33E-06	2.30E-08	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	7.18E-07	7.18E-07	mr1428	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	6.29E-06	mr1469	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	4.26E-06	8.36E-08	mr1550	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	1.50E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	5.37E-07	5.37E-07	mr1869	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	NA	1.85E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117083295	6.81E-06	6.81E-06	mr1996	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251