\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116841704:

Variant ID: vg1116841704 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16841704
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCGTCGTTTCGAAGGTTCGCGTGTGCGTCGGGAGTATTCAAGAAGATTAATTGAAGACCGATTATTGCAAGGCAAGTCACACAGATCCCAAACACAAT[A/T]
CCTTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTATTTCAACTATGAATTTATTTTCGAATGTCACCGGGTGGTGTGAACCTGTTCCTTTGTTAT

Reverse complement sequence

ATAACAAAGGAACAGGTTCACACCACCCGGTGACATTCGAAAATAAATTCATAGTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAGG[T/A]
ATTGTGTTTGGGATCTGTGTGACTTGCCTTGCAATAATCGGTCTTCAATTAATCTTCTTGAATACTCCCGACGCACACGCGAACCTTCGAAACGACGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 0.20% 0.42% 1.88% NA
All Indica  2759 96.80% 0.30% 0.58% 2.32% NA
All Japonica  1512 98.40% 0.00% 0.13% 1.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.20% 0.17% 1.85% NA
Indica II  465 97.00% 0.20% 0.43% 2.37% NA
Indica III  913 95.80% 0.50% 0.99% 2.63% NA
Indica Intermediate  786 96.90% 0.30% 0.51% 2.29% NA
Temperate Japonica  767 99.20% 0.00% 0.13% 0.65% NA
Tropical Japonica  504 99.00% 0.00% 0.20% 0.79% NA
Japonica Intermediate  241 94.60% 0.00% 0.00% 5.39% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 2.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116841704 A -> T LOC_Os11g29074.1 upstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N
vg1116841704 A -> T LOC_Os11g29060.1 downstream_gene_variant ; 2916.0bp to feature; MODIFIER silent_mutation Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N
vg1116841704 A -> T LOC_Os11g29060-LOC_Os11g29074 intergenic_region ; MODIFIER silent_mutation Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N
vg1116841704 A -> DEL N N silent_mutation Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116841704 8.48E-07 1.14E-06 mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116841704 2.58E-06 9.60E-08 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251