Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1116841704:

Variant ID: vg1116841704 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16841704
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCGTCGTTTCGAAGGTTCGCGTGTGCGTCGGGAGTATTCAAGAAGATTAATTGAAGACCGATTATTGCAAGGCAAGTCACACAGATCCCAAACACAAT[A/T]
CCTTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTATTTCAACTATGAATTTATTTTCGAATGTCACCGGGTGGTGTGAACCTGTTCCTTTGTTAT

Reverse complement sequence

ATAACAAAGGAACAGGTTCACACCACCCGGTGACATTCGAAAATAAATTCATAGTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAGG[T/A]
ATTGTGTTTGGGATCTGTGTGACTTGCCTTGCAATAATCGGTCTTCAATTAATCTTCTTGAATACTCCCGACGCACACGCGAACCTTCGAAACGACGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	0.20%	0.42%	1.88%	NA
All Indica	2759	96.80%	0.30%	0.58%	2.32%	NA
All Japonica	1512	98.40%	0.00%	0.13%	1.46%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	0.20%	0.17%	1.85%	NA
Indica II	465	97.00%	0.20%	0.43%	2.37%	NA
Indica III	913	95.80%	0.50%	0.99%	2.63%	NA
Indica Intermediate	786	96.90%	0.30%	0.51%	2.29%	NA
Temperate Japonica	767	99.20%	0.00%	0.13%	0.65%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	94.60%	0.00%	0.00%	5.39%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	2.20%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116841704	A -> T	LOC_Os11g29074.1	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264	N	N	N	N
vg1116841704	A -> T	LOC_Os11g29060.1	downstream_gene_variant ; 2916.0bp to feature; MODIFIER	silent_mutation	Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264	N	N	N	N
vg1116841704	A -> T	LOC_Os11g29060-LOC_Os11g29074	intergenic_region ; MODIFIER	silent_mutation	Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264	N	N	N	N
vg1116841704	A -> DEL	N	N	silent_mutation	Average:19.177; most accessible tissue: Zhenshan97 flag leaf, score: 32.264	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116841704	8.48E-07	1.14E-06	mr1695	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116841704	2.58E-06	9.60E-08	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251