\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116636322:

Variant ID: vg1116636322 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16636322
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ACACATGAGTTCATAGCTGAAATACCAAATGCACATACACGAGAGTCTAGTGCGAATTATTACAACATAAGCCCGCAGGCATTGTCTTAAATCATCGGAC[T/C]
GGGCTGTCCGGAATACATCCCAAAAGTAGAAATGGATAAGGCAGCGGCACGCCATTGCCACAGGCAACGACCGTACTAAGACCTACTGAGCGCCATCGTC

Reverse complement sequence

GACGATGGCGCTCAGTAGGTCTTAGTACGGTCGTTGCCTGTGGCAATGGCGTGCCGCTGCCTTATCCATTTCTACTTTTGGGATGTATTCCGGACAGCCC[A/G]
GTCCGATGATTTAAGACAATGCCTGCGGGCTTATGTTGTAATAATTCGCACTAGACTCTCGTGTATGTGCATTTGGTATTTCAGCTATGAACTCATGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 2.30% 23.91% 38.76% NA
All Indica  2759 3.20% 3.20% 32.15% 61.51% NA
All Japonica  1512 93.50% 0.40% 0.79% 5.36% NA
Aus  269 10.00% 5.90% 76.21% 7.81% NA
Indica I  595 2.70% 0.80% 20.00% 76.47% NA
Indica II  465 2.20% 3.40% 23.01% 71.40% NA
Indica III  913 1.30% 5.80% 46.22% 46.66% NA
Indica Intermediate  786 6.40% 1.70% 30.41% 61.58% NA
Temperate Japonica  767 96.10% 0.10% 0.26% 3.52% NA
Tropical Japonica  504 88.70% 0.80% 1.79% 8.73% NA
Japonica Intermediate  241 95.00% 0.40% 0.41% 4.15% NA
VI/Aromatic  96 91.70% 1.00% 6.25% 1.04% NA
Intermediate  90 41.10% 1.10% 22.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116636322 T -> DEL N N silent_mutation Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1116636322 T -> C LOC_Os11g28740.1 upstream_gene_variant ; 2427.0bp to feature; MODIFIER silent_mutation Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1116636322 T -> C LOC_Os11g28730-LOC_Os11g28740 intergenic_region ; MODIFIER silent_mutation Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116636322 2.34E-06 NA mr1134 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 1.28E-07 1.83E-80 mr1135 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 6.00E-06 2.90E-85 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 1.78E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 1.30E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 2.96E-06 3.74E-86 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 7.28E-08 2.62E-97 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 4.09E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 4.09E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 1.14E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 1.94E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 6.51E-08 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 6.11E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322 NA 8.98E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251