Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116636322:

Variant ID: vg1116636322 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16636322
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

ACACATGAGTTCATAGCTGAAATACCAAATGCACATACACGAGAGTCTAGTGCGAATTATTACAACATAAGCCCGCAGGCATTGTCTTAAATCATCGGAC[T/C]
GGGCTGTCCGGAATACATCCCAAAAGTAGAAATGGATAAGGCAGCGGCACGCCATTGCCACAGGCAACGACCGTACTAAGACCTACTGAGCGCCATCGTC

Reverse complement sequence

GACGATGGCGCTCAGTAGGTCTTAGTACGGTCGTTGCCTGTGGCAATGGCGTGCCGCTGCCTTATCCATTTCTACTTTTGGGATGTATTCCGGACAGCCC[A/G]
GTCCGATGATTTAAGACAATGCCTGCGGGCTTATGTTGTAATAATTCGCACTAGACTCTCGTGTATGTGCATTTGGTATTTCAGCTATGAACTCATGTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	2.30%	23.91%	38.76%	NA
All Indica	2759	3.20%	3.20%	32.15%	61.51%	NA
All Japonica	1512	93.50%	0.40%	0.79%	5.36%	NA
Aus	269	10.00%	5.90%	76.21%	7.81%	NA
Indica I	595	2.70%	0.80%	20.00%	76.47%	NA
Indica II	465	2.20%	3.40%	23.01%	71.40%	NA
Indica III	913	1.30%	5.80%	46.22%	46.66%	NA
Indica Intermediate	786	6.40%	1.70%	30.41%	61.58%	NA
Temperate Japonica	767	96.10%	0.10%	0.26%	3.52%	NA
Tropical Japonica	504	88.70%	0.80%	1.79%	8.73%	NA
Japonica Intermediate	241	95.00%	0.40%	0.41%	4.15%	NA
VI/Aromatic	96	91.70%	1.00%	6.25%	1.04%	NA
Intermediate	90	41.10%	1.10%	22.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116636322	T -> DEL	N	N	silent_mutation	Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1116636322	T -> C	LOC_Os11g28740.1	upstream_gene_variant ; 2427.0bp to feature; MODIFIER	silent_mutation	Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1116636322	T -> C	LOC_Os11g28730-LOC_Os11g28740	intergenic_region ; MODIFIER	silent_mutation	Average:22.9; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116636322	2.34E-06	NA	mr1134	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	1.28E-07	1.83E-80	mr1135	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	6.00E-06	2.90E-85	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	1.78E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	1.30E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	2.96E-06	3.74E-86	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	7.28E-08	2.62E-97	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	4.09E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	4.09E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	1.14E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	1.94E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	6.51E-08	mr1758_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	6.11E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116636322	NA	8.98E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251