\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116585583:

Variant ID: vg1116585583 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16585583
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATTTTATTTTCCTCGAAATCGATTATCGCTGGCGGCTGTCATAGCACAACCGCCTGCAAAATTTGATTATTGCTGGCGGTCCTCGTAAGGCTGCAGC[C/A]
AGCGAAGATATTTTTCGCTGGCGGCTGTCTTAAGCAGGACGCCAATGAAAATACATTTTTGCTAGCGACTGCCTTAAGACAGCCGCTAGCGAAGATATAT

Reverse complement sequence

ATATATCTTCGCTAGCGGCTGTCTTAAGGCAGTCGCTAGCAAAAATGTATTTTCATTGGCGTCCTGCTTAAGACAGCCGCCAGCGAAAAATATCTTCGCT[G/T]
GCTGCAGCCTTACGAGGACCGCCAGCAATAATCAAATTTTGCAGGCGGTTGTGCTATGACAGCCGCCAGCGATAATCGATTTCGAGGAAAATAAAATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 10.50% 3.85% 13.46% NA
All Indica  2759 78.50% 13.60% 3.26% 4.68% NA
All Japonica  1512 56.70% 4.00% 5.89% 33.33% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 91.60% 5.40% 1.85% 1.18% NA
Indica II  465 92.00% 4.50% 0.86% 2.58% NA
Indica III  913 61.40% 24.00% 6.35% 8.21% NA
Indica Intermediate  786 80.30% 13.10% 2.16% 4.45% NA
Temperate Japonica  767 85.10% 1.20% 2.35% 11.34% NA
Tropical Japonica  504 25.00% 9.10% 9.13% 56.75% NA
Japonica Intermediate  241 32.80% 2.50% 10.37% 54.36% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 12.20% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116585583 C -> A LOC_Os11g28690.1 upstream_gene_variant ; 3821.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1116585583 C -> A LOC_Os11g28680.1 downstream_gene_variant ; 3143.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1116585583 C -> A LOC_Os11g28680-LOC_Os11g28690 intergenic_region ; MODIFIER silent_mutation Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1116585583 C -> DEL N N silent_mutation Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116585583 NA 3.19E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 8.82E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 2.42E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 5.33E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 1.29E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 6.37E-09 1.01E-08 mr1919 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 1.71E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583 NA 8.77E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251