\
| Variant ID: vg1116585583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16585583 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 112. )
TTTATTTTATTTTCCTCGAAATCGATTATCGCTGGCGGCTGTCATAGCACAACCGCCTGCAAAATTTGATTATTGCTGGCGGTCCTCGTAAGGCTGCAGC[C/A]
AGCGAAGATATTTTTCGCTGGCGGCTGTCTTAAGCAGGACGCCAATGAAAATACATTTTTGCTAGCGACTGCCTTAAGACAGCCGCTAGCGAAGATATAT
ATATATCTTCGCTAGCGGCTGTCTTAAGGCAGTCGCTAGCAAAAATGTATTTTCATTGGCGTCCTGCTTAAGACAGCCGCCAGCGAAAAATATCTTCGCT[G/T]
GCTGCAGCCTTACGAGGACCGCCAGCAATAATCAAATTTTGCAGGCGGTTGTGCTATGACAGCCGCCAGCGATAATCGATTTCGAGGAAAATAAAATAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 10.50% | 3.85% | 13.46% | NA |
| All Indica | 2759 | 78.50% | 13.60% | 3.26% | 4.68% | NA |
| All Japonica | 1512 | 56.70% | 4.00% | 5.89% | 33.33% | NA |
| Aus | 269 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 5.40% | 1.85% | 1.18% | NA |
| Indica II | 465 | 92.00% | 4.50% | 0.86% | 2.58% | NA |
| Indica III | 913 | 61.40% | 24.00% | 6.35% | 8.21% | NA |
| Indica Intermediate | 786 | 80.30% | 13.10% | 2.16% | 4.45% | NA |
| Temperate Japonica | 767 | 85.10% | 1.20% | 2.35% | 11.34% | NA |
| Tropical Japonica | 504 | 25.00% | 9.10% | 9.13% | 56.75% | NA |
| Japonica Intermediate | 241 | 32.80% | 2.50% | 10.37% | 54.36% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 12.20% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116585583 | C -> A | LOC_Os11g28690.1 | upstream_gene_variant ; 3821.0bp to feature; MODIFIER | silent_mutation | Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1116585583 | C -> A | LOC_Os11g28680.1 | downstream_gene_variant ; 3143.0bp to feature; MODIFIER | silent_mutation | Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1116585583 | C -> A | LOC_Os11g28680-LOC_Os11g28690 | intergenic_region ; MODIFIER | silent_mutation | Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1116585583 | C -> DEL | N | N | silent_mutation | Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116585583 | NA | 3.19E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 8.82E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 2.42E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 5.33E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 1.29E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | 6.37E-09 | 1.01E-08 | mr1919 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 1.71E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116585583 | NA | 8.77E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |