\
| Variant ID: vg1116565892 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16565892 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.30, others allele: 0.00, population size: 168. )
AAAGAAAATAATGGCGGTATGTTATTTGCTCGAATTTTACTTAATTTACACATCACTCAAATTGGTGGTCTGTACTTTAAAAATAGCATGAAATTTTGAT[G/A]
CTTCAAACAACTAATTCAATTTGAAGAAGCCAAGCAGGTAAGAATCGAGTGTTTTATTGCGTGTAGTGTGCAACATGCATGTGCTCCCTATATGCTGCAC
GTGCAGCATATAGGGAGCACATGCATGTTGCACACTACACGCAATAAAACACTCGATTCTTACCTGCTTGGCTTCTTCAAATTGAATTAGTTGTTTGAAG[C/T]
ATCAAAATTTCATGCTATTTTTAAAGTACAGACCACCAATTTGAGTGATGTGTAAATTAAGTAAAATTCGAGCAAATAACATACCGCCATTATTTTCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 14.80% | 1.93% | 43.21% | NA |
| All Indica | 2759 | 4.80% | 23.30% | 2.86% | 69.01% | NA |
| All Japonica | 1512 | 93.60% | 0.70% | 0.40% | 5.29% | NA |
| Aus | 269 | 83.30% | 7.10% | 0.37% | 9.29% | NA |
| Indica I | 595 | 2.20% | 12.10% | 3.70% | 82.02% | NA |
| Indica II | 465 | 1.50% | 46.50% | 1.51% | 50.54% | NA |
| Indica III | 913 | 3.90% | 17.00% | 3.18% | 75.90% | NA |
| Indica Intermediate | 786 | 9.70% | 25.60% | 2.67% | 62.09% | NA |
| Temperate Japonica | 767 | 96.10% | 0.70% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 88.90% | 0.80% | 0.60% | 9.72% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.80% | 0.83% | 2.90% | NA |
| VI/Aromatic | 96 | 90.60% | 7.30% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 37.80% | 22.20% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116565892 | G -> A | LOC_Os11g28650.1 | upstream_gene_variant ; 4414.0bp to feature; MODIFIER | silent_mutation | Average:32.446; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1116565892 | G -> A | LOC_Os11g28640-LOC_Os11g28650 | intergenic_region ; MODIFIER | silent_mutation | Average:32.446; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1116565892 | G -> DEL | N | N | silent_mutation | Average:32.446; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116565892 | 7.23E-06 | NA | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1116565892 | 4.00E-06 | 3.59E-12 | Heading_date | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1116565892 | NA | 8.32E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116565892 | NA | 3.19E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116565892 | NA | 9.33E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116565892 | NA | 8.95E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116565892 | NA | 3.57E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |