Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1116476110:

Variant ID: vg1116476110 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16476110
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATTATTATTATGGTAGCCCCCGACTGACAACCTCAAGAAAAAGCTTGATGTTGACAGTCAAGACAGGGAAATACATAGATAAACTTAAGCGTAGAAA[C/T]
GACGAAGATGTTTGATATTCCAAGAGTTGTCGACAAGTGTACCATCTTCGCGCTTAAGTCGATAAGAACCTGGTCAAGTAACTTCAGAGATTATGAATGG

Reverse complement sequence

CCATTCATAATCTCTGAAGTTACTTGACCAGGTTCTTATCGACTTAAGCGCGAAGATGGTACACTTGTCGACAACTCTTGGAATATCAAACATCTTCGTC[G/A]
TTTCTACGCTTAAGTTTATCTATGTATTTCCCTGTCTTGACTGTCAACATCAAGCTTTTTCTTGAGGTTGTCAGTCGGGGGCTACCATAATAATAATGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.20%	47.60%	1.04%	2.18%	NA
All Indica	2759	17.80%	78.50%	1.09%	2.61%	NA
All Japonica	1512	94.90%	3.20%	0.13%	1.72%	NA
Aus	269	94.10%	0.70%	4.83%	0.37%	NA
Indica I	595	17.30%	82.00%	0.67%	0.00%	NA
Indica II	465	6.50%	90.10%	1.08%	2.37%	NA
Indica III	913	22.90%	69.60%	1.53%	6.02%	NA
Indica Intermediate	786	18.80%	79.50%	0.89%	0.76%	NA
Temperate Japonica	767	97.30%	2.70%	0.00%	0.00%	NA
Tropical Japonica	504	90.50%	4.20%	0.40%	4.96%	NA
Japonica Intermediate	241	96.70%	2.90%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	33.30%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116476110	C -> T	LOC_Os11g28550.1	upstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg1116476110	C -> T	LOC_Os11g28560.1	downstream_gene_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg1116476110	C -> T	LOC_Os11g28570.1	downstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg1116476110	C -> T	LOC_Os11g28580.1	downstream_gene_variant ; 3441.0bp to feature; MODIFIER	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg1116476110	C -> T	LOC_Os11g28560-LOC_Os11g28570	intergenic_region ; MODIFIER	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg1116476110	C -> DEL	N	N	silent_mutation	Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116476110	NA	8.39E-36	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	3.35E-35	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	3.01E-22	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	6.54E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	2.71E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	1.26E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110	NA	1.96E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251