\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116476110:

Variant ID: vg1116476110 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16476110
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATTATTATTATGGTAGCCCCCGACTGACAACCTCAAGAAAAAGCTTGATGTTGACAGTCAAGACAGGGAAATACATAGATAAACTTAAGCGTAGAAA[C/T]
GACGAAGATGTTTGATATTCCAAGAGTTGTCGACAAGTGTACCATCTTCGCGCTTAAGTCGATAAGAACCTGGTCAAGTAACTTCAGAGATTATGAATGG

Reverse complement sequence

CCATTCATAATCTCTGAAGTTACTTGACCAGGTTCTTATCGACTTAAGCGCGAAGATGGTACACTTGTCGACAACTCTTGGAATATCAAACATCTTCGTC[G/A]
TTTCTACGCTTAAGTTTATCTATGTATTTCCCTGTCTTGACTGTCAACATCAAGCTTTTTCTTGAGGTTGTCAGTCGGGGGCTACCATAATAATAATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 47.60% 1.04% 2.18% NA
All Indica  2759 17.80% 78.50% 1.09% 2.61% NA
All Japonica  1512 94.90% 3.20% 0.13% 1.72% NA
Aus  269 94.10% 0.70% 4.83% 0.37% NA
Indica I  595 17.30% 82.00% 0.67% 0.00% NA
Indica II  465 6.50% 90.10% 1.08% 2.37% NA
Indica III  913 22.90% 69.60% 1.53% 6.02% NA
Indica Intermediate  786 18.80% 79.50% 0.89% 0.76% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 4.20% 0.40% 4.96% NA
Japonica Intermediate  241 96.70% 2.90% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 33.30% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116476110 C -> T LOC_Os11g28550.1 upstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1116476110 C -> T LOC_Os11g28560.1 downstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1116476110 C -> T LOC_Os11g28570.1 downstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1116476110 C -> T LOC_Os11g28580.1 downstream_gene_variant ; 3441.0bp to feature; MODIFIER silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1116476110 C -> T LOC_Os11g28560-LOC_Os11g28570 intergenic_region ; MODIFIER silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1116476110 C -> DEL N N silent_mutation Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116476110 NA 8.39E-36 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 3.35E-35 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 3.01E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 6.54E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 2.71E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 1.26E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116476110 NA 1.96E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251