\
| Variant ID: vg1116476110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16476110 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )
TCCATTATTATTATGGTAGCCCCCGACTGACAACCTCAAGAAAAAGCTTGATGTTGACAGTCAAGACAGGGAAATACATAGATAAACTTAAGCGTAGAAA[C/T]
GACGAAGATGTTTGATATTCCAAGAGTTGTCGACAAGTGTACCATCTTCGCGCTTAAGTCGATAAGAACCTGGTCAAGTAACTTCAGAGATTATGAATGG
CCATTCATAATCTCTGAAGTTACTTGACCAGGTTCTTATCGACTTAAGCGCGAAGATGGTACACTTGTCGACAACTCTTGGAATATCAAACATCTTCGTC[G/A]
TTTCTACGCTTAAGTTTATCTATGTATTTCCCTGTCTTGACTGTCAACATCAAGCTTTTTCTTGAGGTTGTCAGTCGGGGGCTACCATAATAATAATGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.20% | 47.60% | 1.04% | 2.18% | NA |
| All Indica | 2759 | 17.80% | 78.50% | 1.09% | 2.61% | NA |
| All Japonica | 1512 | 94.90% | 3.20% | 0.13% | 1.72% | NA |
| Aus | 269 | 94.10% | 0.70% | 4.83% | 0.37% | NA |
| Indica I | 595 | 17.30% | 82.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 6.50% | 90.10% | 1.08% | 2.37% | NA |
| Indica III | 913 | 22.90% | 69.60% | 1.53% | 6.02% | NA |
| Indica Intermediate | 786 | 18.80% | 79.50% | 0.89% | 0.76% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 4.20% | 0.40% | 4.96% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 33.30% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116476110 | C -> T | LOC_Os11g28550.1 | upstream_gene_variant ; 4771.0bp to feature; MODIFIER | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1116476110 | C -> T | LOC_Os11g28560.1 | downstream_gene_variant ; 337.0bp to feature; MODIFIER | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1116476110 | C -> T | LOC_Os11g28570.1 | downstream_gene_variant ; 84.0bp to feature; MODIFIER | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1116476110 | C -> T | LOC_Os11g28580.1 | downstream_gene_variant ; 3441.0bp to feature; MODIFIER | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1116476110 | C -> T | LOC_Os11g28560-LOC_Os11g28570 | intergenic_region ; MODIFIER | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1116476110 | C -> DEL | N | N | silent_mutation | Average:22.403; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116476110 | NA | 8.39E-36 | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 3.35E-35 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 3.01E-22 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 6.54E-13 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 2.71E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 1.26E-10 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116476110 | NA | 1.96E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |