Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115847531:

Variant ID: vg1115847531 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15847531
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCCTCTGAAGTGTATAAGTAAACAAATATTGTTCAACATACTCAACATACACAAAAAAAACAACTATTCCAGAAAAAGGGGCAATTTTTGCTAGAGTA[C/T]
ACCCAAAATATGTGCAATTTGTTGATAGACGTCGAAAAAATATGTCACGGCTGAAGCACGTCCTAAAAAACTGGTAATCTGCTAGAGAACACTTTCGGTT

Reverse complement sequence

AACCGAAAGTGTTCTCTAGCAGATTACCAGTTTTTTAGGACGTGCTTCAGCCGTGACATATTTTTTCGACGTCTATCAACAAATTGCACATATTTTGGGT[G/A]
TACTCTAGCAAAAATTGCCCCTTTTTCTGGAATAGTTGTTTTTTTTGTGTATGTTGAGTATGTTGAACAATATTTGTTTACTTATACACTTCAGAGGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	4.70%	0.78%	0.00%	NA
All Indica	2759	99.50%	0.40%	0.07%	0.00%	NA
All Japonica	1512	84.30%	13.50%	2.25%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	94.40%	2.70%	2.87%	0.00%	NA
Tropical Japonica	504	77.40%	22.40%	0.20%	0.00%	NA
Japonica Intermediate	241	66.40%	29.00%	4.56%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115847531	C -> T	LOC_Os11g27530.1	downstream_gene_variant ; 3130.0bp to feature; MODIFIER	silent_mutation	Average:28.907; most accessible tissue: Callus, score: 56.305	N	N	N	N
vg1115847531	C -> T	LOC_Os11g27540.1	downstream_gene_variant ; 3584.0bp to feature; MODIFIER	silent_mutation	Average:28.907; most accessible tissue: Callus, score: 56.305	N	N	N	N
vg1115847531	C -> T	LOC_Os11g27540.2	downstream_gene_variant ; 3168.0bp to feature; MODIFIER	silent_mutation	Average:28.907; most accessible tissue: Callus, score: 56.305	N	N	N	N
vg1115847531	C -> T	LOC_Os11g27530-LOC_Os11g27540	intergenic_region ; MODIFIER	silent_mutation	Average:28.907; most accessible tissue: Callus, score: 56.305	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115847531	NA	9.11E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	8.48E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	4.27E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	1.12E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	2.35E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	1.66E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	4.89E-06	1.63E-06	mr1150	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	3.02E-06	9.16E-09	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	5.31E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	3.36E-06	5.89E-09	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	1.07E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	2.14E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115847531	NA	1.27E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251