Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1115517044:

Variant ID: vg1115517044 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15517044
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATGCCACGTCAAATGAAGACCGAGTCAAATTAGCAACGTAGGCGTCACGTCAGTAAAAACCGCCGAGGGACCTCATTTACACTGGTTTTAACAATTGAG[A/G]
GACGCGTTGTATCTGGTTTTCTGGTTGAAGGACGAAAATCGGATTCGTCGACAAGTTTACAGATCTCAGATGAACTTATTCCATTCACGAACGGACGAAC

Reverse complement sequence

GTTCGTCCGTTCGTGAATGGAATAAGTTCATCTGAGATCTGTAAACTTGTCGACGAATCCGATTTTCGTCCTTCAACCAGAAAACCAGATACAACGCGTC[T/C]
CTCAATTGTTAAAACCAGTGTAAATGAGGTCCCTCGGCGGTTTTTACTGACGTGACGCCTACGTTGCTAATTTGACTCGGTCTTCATTTGACGTGGCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.90% 0.13% 0.13% NA
All Indica  2759 92.20% 7.40% 0.18% 0.18% NA
All Japonica  1512 3.60% 96.30% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 79.00% 20.70% 0.34% 0.00% NA
Indica II  465 99.10% 0.20% 0.43% 0.22% NA
Indica III  913 97.80% 2.10% 0.00% 0.11% NA
Indica Intermediate  786 91.70% 7.80% 0.13% 0.38% NA
Temperate Japonica  767 3.90% 96.00% 0.00% 0.13% NA
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115517044 A -> DEL N N silent_mutation Average:82.022; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg1115517044 A -> G LOC_Os11g26970.1 upstream_gene_variant ; 851.0bp to feature; MODIFIER silent_mutation Average:82.022; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg1115517044 A -> G LOC_Os11g26980.1 upstream_gene_variant ; 4733.0bp to feature; MODIFIER silent_mutation Average:82.022; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg1115517044 A -> G LOC_Os11g26956-LOC_Os11g26970 intergenic_region ; MODIFIER silent_mutation Average:82.022; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1115517044 A G 0.01 0.04 0.02 0.03 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115517044 NA 3.59E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 6.99E-13 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.30E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.83E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.79E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 5.89E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 5.66E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.05E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 5.66E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 3.87E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 6.06E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 2.08E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.23E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.41E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 2.08E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.02E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 6.85E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 5.31E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 7.43E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 4.18E-19 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 6.52E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 1.42E-25 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 4.38E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 6.08E-16 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 2.58E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 9.82E-34 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 1.34E-06 NA mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 4.17E-08 7.08E-08 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 9.04E-06 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 4.91E-08 5.54E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115517044 NA 5.83E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251