Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115480914:

Variant ID: vg1115480914 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15480914
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CAATGGAGGAGCTCGTCGGCAAATATATTCCACACCTTGCCGAAGGTCGGCAAGCTGCTTAAACCCTTCTAGGTACCTGATAGATGCTCTAGAACCCCTC[C/T]
CCGAGCCATGTCTAACTCACATAACCCTGATCACCTTCACGGCTTAACTATGCCACCGCCGCCCTAGCCGCTAGCTCAACCACATACCAAATTAACCCCT

Reverse complement sequence

AGGGGTTAATTTGGTATGTGGTTGAGCTAGCGGCTAGGGCGGCGGTGGCATAGTTAAGCCGTGAAGGTGATCAGGGTTATGTGAGTTAGACATGGCTCGG[G/A]
GAGGGGTTCTAGAGCATCTATCAGGTACCTAGAAGGGTTTAAGCAGCTTGCCGACCTTCGGCAAGGTGTGGAATATATTTGCCGACGAGCTCCTCCATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	30.10%	0.28%	1.63%	NA
All Indica	2759	50.30%	46.40%	0.47%	2.79%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	60.20%	39.80%	0.00%	0.00%	NA
Indica I	595	23.50%	76.10%	0.17%	0.17%	NA
Indica II	465	62.60%	36.10%	0.65%	0.65%	NA
Indica III	913	56.30%	37.90%	0.55%	5.26%	NA
Indica Intermediate	786	56.40%	39.90%	0.51%	3.18%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115480914	C -> T	LOC_Os11g26920.1	upstream_gene_variant ; 4663.0bp to feature; MODIFIER	silent_mutation	Average:48.204; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg1115480914	C -> T	LOC_Os11g26930.1	upstream_gene_variant ; 4853.0bp to feature; MODIFIER	silent_mutation	Average:48.204; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg1115480914	C -> T	LOC_Os11g26920-LOC_Os11g26930	intergenic_region ; MODIFIER	silent_mutation	Average:48.204; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg1115480914	C -> DEL	N	N	silent_mutation	Average:48.204; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115480914	NA	3.09E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	NA	1.45E-10	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	NA	6.30E-06	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	NA	8.39E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	NA	7.23E-06	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	NA	2.36E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	7.59E-06	NA	mr1092_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	3.85E-06	2.32E-07	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	1.69E-09	3.26E-17	mr1097_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	1.83E-09	7.17E-12	mr1097_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	8.20E-08	NA	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	3.66E-06	3.22E-07	mr1102_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	5.72E-06	2.16E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	2.01E-09	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	2.28E-10	3.40E-14	mr1154_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	2.50E-08	NA	mr1223_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115480914	8.02E-07	8.52E-07	mr1223_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251