\
| Variant ID: vg1115409967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15409967 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 209. )
TCTAGTATTCAGATAGATGACTTTTGATCAATCTTGTGTTCCCTTAGTTGTGTGTAGGGTTGTTGGTTGTGTGCACTTTCGTGGTGCAGAGGCCGCGAGT[G/A]
TACTAAGACTCTTGAGTTCAATAAAGCTTCCATTATATACAAAACCTAAGGGTGTATGTGGCTAACCCACAAATCCACTTATAAGTTAAATATGGGTTAG
CTAACCCATATTTAACTTATAAGTGGATTTGTGGGTTAGCCACATACACCCTTAGGTTTTGTATATAATGGAAGCTTTATTGAACTCAAGAGTCTTAGTA[C/T]
ACTCGCGGCCTCTGCACCACGAAAGTGCACACAACCAACAACCCTACACACAACTAAGGGAACACAAGATTGATCAAAAGTCATCTATCTGAATACTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 35.70% | 0.25% | 0.08% | NA |
| All Indica | 2759 | 48.40% | 51.00% | 0.43% | 0.14% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.10% | 82.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 59.40% | 39.80% | 0.65% | 0.22% | NA |
| Indica III | 913 | 60.90% | 38.70% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 51.00% | 48.20% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115409967 | G -> A | LOC_Os11g26830.1 | upstream_gene_variant ; 697.0bp to feature; MODIFIER | silent_mutation | Average:51.768; most accessible tissue: Callus, score: 78.112 | N | N | N | N |
| vg1115409967 | G -> A | LOC_Os11g26830-LOC_Os11g26840 | intergenic_region ; MODIFIER | silent_mutation | Average:51.768; most accessible tissue: Callus, score: 78.112 | N | N | N | N |
| vg1115409967 | G -> DEL | N | N | silent_mutation | Average:51.768; most accessible tissue: Callus, score: 78.112 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115409967 | NA | 4.33E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | 6.68E-06 | 5.19E-15 | mr1097 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 1.08E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 3.80E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 7.37E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 1.58E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 1.21E-09 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 8.58E-07 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 1.27E-13 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 1.37E-07 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 6.16E-07 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | 1.22E-06 | 1.48E-16 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | 7.30E-07 | 2.04E-10 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 4.97E-06 | mr1102_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | NA | 4.18E-07 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | 8.56E-08 | NA | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115409967 | 2.53E-08 | 1.00E-13 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |