\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115403686:

Variant ID: vg1115403686 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15403686
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCACCTACTTTCACAATCATCTCCCTCTATTTGACGTAGAGGGAGGAGTGGAGGAGGAGAGCCCTCGGTGGCTTGGCGAGCCGTGGGCCGCCGCCTGT[C/T]
ACCTCCCCTTCGACGGAAGGGAGGGCGCCATCGCCTGCTGCACGCCGATGTAGAGGGAGGAGTGGAGGAGAAGATAAGGAGGACGAGTGAATTAAGACGG

Reverse complement sequence

CCGTCTTAATTCACTCGTCCTCCTTATCTTCTCCTCCACTCCTCCCTCTACATCGGCGTGCAGCAGGCGATGGCGCCCTCCCTTCCGTCGAAGGGGAGGT[G/A]
ACAGGCGGCGGCCCACGGCTCGCCAAGCCACCGAGGGCTCTCCTCCTCCACTCCTCCCTCTACGTCAAATAGAGGGAGATGATTGTGAAAGTAGGTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 25.70% 0.25% 0.42% NA
All Indica  2759 63.00% 36.00% 0.40% 0.58% NA
All Japonica  1512 98.10% 1.70% 0.07% 0.20% NA
Aus  269 41.30% 58.70% 0.00% 0.00% NA
Indica I  595 92.10% 7.60% 0.17% 0.17% NA
Indica II  465 48.00% 50.80% 0.22% 1.08% NA
Indica III  913 53.70% 45.20% 0.66% 0.44% NA
Indica Intermediate  786 60.70% 38.20% 0.38% 0.76% NA
Temperate Japonica  767 98.30% 1.40% 0.00% 0.26% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 5.20% 0.00% 1.04% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115403686 C -> T LOC_Os11g26830.1 downstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1115403686 C -> T LOC_Os11g26810-LOC_Os11g26830 intergenic_region ; MODIFIER silent_mutation Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1115403686 C -> DEL N N silent_mutation Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115403686 NA 3.55E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 3.99E-06 NA mr1244 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 8.04E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 6.88E-14 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 5.91E-10 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 2.63E-11 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 4.00E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 4.20E-08 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 3.58E-11 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 1.24E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115403686 NA 7.00E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251