Variant ID: vg1115403686 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 15403686 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 111. )
TTTCACCTACTTTCACAATCATCTCCCTCTATTTGACGTAGAGGGAGGAGTGGAGGAGGAGAGCCCTCGGTGGCTTGGCGAGCCGTGGGCCGCCGCCTGT[C/T]
ACCTCCCCTTCGACGGAAGGGAGGGCGCCATCGCCTGCTGCACGCCGATGTAGAGGGAGGAGTGGAGGAGAAGATAAGGAGGACGAGTGAATTAAGACGG
CCGTCTTAATTCACTCGTCCTCCTTATCTTCTCCTCCACTCCTCCCTCTACATCGGCGTGCAGCAGGCGATGGCGCCCTCCCTTCCGTCGAAGGGGAGGT[G/A]
ACAGGCGGCGGCCCACGGCTCGCCAAGCCACCGAGGGCTCTCCTCCTCCACTCCTCCCTCTACGTCAAATAGAGGGAGATGATTGTGAAAGTAGGTGAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 73.60% | 25.70% | 0.25% | 0.42% | NA |
All Indica | 2759 | 63.00% | 36.00% | 0.40% | 0.58% | NA |
All Japonica | 1512 | 98.10% | 1.70% | 0.07% | 0.20% | NA |
Aus | 269 | 41.30% | 58.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.10% | 7.60% | 0.17% | 0.17% | NA |
Indica II | 465 | 48.00% | 50.80% | 0.22% | 1.08% | NA |
Indica III | 913 | 53.70% | 45.20% | 0.66% | 0.44% | NA |
Indica Intermediate | 786 | 60.70% | 38.20% | 0.38% | 0.76% | NA |
Temperate Japonica | 767 | 98.30% | 1.40% | 0.00% | 0.26% | NA |
Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 93.80% | 5.20% | 0.00% | 1.04% | NA |
Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1115403686 | C -> T | LOC_Os11g26830.1 | downstream_gene_variant ; 754.0bp to feature; MODIFIER | silent_mutation | Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
vg1115403686 | C -> T | LOC_Os11g26810-LOC_Os11g26830 | intergenic_region ; MODIFIER | silent_mutation | Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
vg1115403686 | C -> DEL | N | N | silent_mutation | Average:61.58; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1115403686 | NA | 3.55E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | 3.99E-06 | NA | mr1244 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 8.04E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 6.88E-14 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 5.91E-10 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 2.63E-11 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 4.00E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 4.20E-08 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 3.58E-11 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 1.24E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115403686 | NA | 7.00E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |