Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115212225:

Variant ID: vg1115212225 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15212225
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TATGCCGCCTAAAAGGGATATAGAGTTCAGAATAGATTTGGTACCAGGAACAATTCCGATCCATAAGAGACCTTATAGAATGGCAGCCAATGAATTGGCA[A/G]
AAGTCAAGAGGCAAGTAGACGAAAGAACGACAGTTGCCATTGGAGTTATGTAAGGAATTTGAAAGATTAAATTTGGGAATTGTCAGTAGAGGTTTTGTTG

Reverse complement sequence

CAACAAAACCTCTACTGACAATTCCCAAATTTAATCTTTCAAATTCCTTACATAACTCCAATGGCAACTGTCGTTCTTTCGTCTACTTGCCTCTTGACTT[T/C]
TGCCAATTCATTGGCTGCCATTCTATAAGGTCTCTTATGGATCGGAATTGTTCCTGGTACCAAATCTATTCTGAACTCTATATCCCTTTTAGGCGGCATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.20%	8.30%	30.03%	36.46%	NA
All Indica	2759	2.40%	0.50%	39.76%	57.34%	NA
All Japonica	1512	65.60%	24.60%	7.61%	2.18%	NA
Aus	269	9.70%	0.00%	60.97%	29.37%	NA
Indica I	595	4.20%	0.50%	18.99%	76.30%	NA
Indica II	465	0.40%	0.90%	31.40%	67.31%	NA
Indica III	913	0.70%	0.20%	60.90%	38.23%	NA
Indica Intermediate	786	4.30%	0.50%	35.88%	59.29%	NA
Temperate Japonica	767	45.00%	43.90%	8.60%	2.48%	NA
Tropical Japonica	504	91.30%	1.40%	4.96%	2.38%	NA
Japonica Intermediate	241	77.60%	11.60%	9.96%	0.83%	NA
VI/Aromatic	96	83.30%	1.00%	13.54%	2.08%	NA
Intermediate	90	30.00%	6.70%	33.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115212225	A -> DEL	LOC_Os11g26540.1	N	frameshift_variant	Average:8.889; most accessible tissue: Callus, score: 26.312	N	N	N	N
vg1115212225	A -> G	LOC_Os11g26540.1	missense_variant ; p.Lys807Glu; MODERATE	nonsynonymous_codon ; K807E	Average:8.889; most accessible tissue: Callus, score: 26.312	benign	-0.319	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115212225	NA	7.42E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.01E-08	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.62E-09	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.85E-07	mr1162	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.24E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	4.11E-06	4.11E-06	mr1169	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.13E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	3.10E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	3.06E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	7.53E-06	mr1359	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	8.24E-07	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	2.16E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	6.89E-06	mr1397	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.22E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	9.17E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	6.49E-06	1.14E-08	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.17E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	7.24E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	8.80E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	2.12E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.44E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	9.96E-06	4.03E-09	mr1804	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	4.20E-07	4.20E-07	mr1804	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	5.00E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	1.64E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	6.14E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225	NA	6.44E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251