\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115212225:

Variant ID: vg1115212225 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15212225
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCCGCCTAAAAGGGATATAGAGTTCAGAATAGATTTGGTACCAGGAACAATTCCGATCCATAAGAGACCTTATAGAATGGCAGCCAATGAATTGGCA[A/G]
AAGTCAAGAGGCAAGTAGACGAAAGAACGACAGTTGCCATTGGAGTTATGTAAGGAATTTGAAAGATTAAATTTGGGAATTGTCAGTAGAGGTTTTGTTG

Reverse complement sequence

CAACAAAACCTCTACTGACAATTCCCAAATTTAATCTTTCAAATTCCTTACATAACTCCAATGGCAACTGTCGTTCTTTCGTCTACTTGCCTCTTGACTT[T/C]
TGCCAATTCATTGGCTGCCATTCTATAAGGTCTCTTATGGATCGGAATTGTTCCTGGTACCAAATCTATTCTGAACTCTATATCCCTTTTAGGCGGCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.20% 8.30% 30.03% 36.46% NA
All Indica  2759 2.40% 0.50% 39.76% 57.34% NA
All Japonica  1512 65.60% 24.60% 7.61% 2.18% NA
Aus  269 9.70% 0.00% 60.97% 29.37% NA
Indica I  595 4.20% 0.50% 18.99% 76.30% NA
Indica II  465 0.40% 0.90% 31.40% 67.31% NA
Indica III  913 0.70% 0.20% 60.90% 38.23% NA
Indica Intermediate  786 4.30% 0.50% 35.88% 59.29% NA
Temperate Japonica  767 45.00% 43.90% 8.60% 2.48% NA
Tropical Japonica  504 91.30% 1.40% 4.96% 2.38% NA
Japonica Intermediate  241 77.60% 11.60% 9.96% 0.83% NA
VI/Aromatic  96 83.30% 1.00% 13.54% 2.08% NA
Intermediate  90 30.00% 6.70% 33.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115212225 A -> DEL LOC_Os11g26540.1 N frameshift_variant Average:8.889; most accessible tissue: Callus, score: 26.312 N N N N
vg1115212225 A -> G LOC_Os11g26540.1 missense_variant ; p.Lys807Glu; MODERATE nonsynonymous_codon ; K807E Average:8.889; most accessible tissue: Callus, score: 26.312 benign -0.319 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115212225 NA 7.42E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.01E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.62E-09 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.85E-07 mr1162 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.24E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 4.11E-06 4.11E-06 mr1169 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.13E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 3.10E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 3.06E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 7.53E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 8.24E-07 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 2.16E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 6.89E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.22E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 9.17E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 6.49E-06 1.14E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.17E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 7.24E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 8.80E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 2.12E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.44E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 9.96E-06 4.03E-09 mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 4.20E-07 4.20E-07 mr1804 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 5.00E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 1.64E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 6.14E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115212225 NA 6.44E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251