\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115066964:

Variant ID: vg1115066964 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15066964
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATCCTCCAATTTAACGTACTTACTTATTCTCGTGCAATAGCCCGAAGGAACTTTAATATTTGCCAGACATGATAGCATTGCAATCTTCTCATCCTTC[G/A]
ACAATGTGTGGCAAGCTGGTGGGAGGTACACTCTTCCTGTCTTCTCATCTGTAACAGGCTGAAGTTCACTGCGAATGTTCATCTCCTGTAGATCGAGACG

Reverse complement sequence

CGTCTCGATCTACAGGAGATGAACATTCGCAGTGAACTTCAGCCTGTTACAGATGAGAAGACAGGAAGAGTGTACCTCCCACCAGCTTGCCACACATTGT[C/T]
GAAGGATGAGAAGATTGCAATGCTATCATGTCTGGCAAATATTAAAGTTCCTTCGGGCTATTGCACGAGAATAAGTAAGTACGTTAAATTGGAGGATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.10% 0.38% 0.30% NA
All Indica  2759 94.90% 4.30% 0.43% 0.36% NA
All Japonica  1512 3.30% 96.70% 0.00% 0.00% NA
Aus  269 97.80% 1.10% 1.12% 0.00% NA
Indica I  595 93.30% 6.40% 0.34% 0.00% NA
Indica II  465 95.50% 3.40% 1.08% 0.00% NA
Indica III  913 97.80% 2.00% 0.22% 0.00% NA
Indica Intermediate  786 92.50% 5.90% 0.38% 1.27% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 86.50% 2.08% 4.17% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115066964 G -> A LOC_Os11g26320.1 missense_variant ; p.Ser624Leu; MODERATE nonsynonymous_codon ; S624L Average:32.811; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 benign 0.178 DELETERIOUS 0.02
vg1115066964 G -> DEL LOC_Os11g26320.1 N frameshift_variant Average:32.811; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115066964 NA 7.19E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 8.09E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 2.83E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 4.14E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 1.69E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 6.86E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 4.88E-06 4.88E-06 mr1262_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 3.72E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 1.02E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 8.15E-06 mr1316_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 2.94E-06 4.69E-06 mr1345_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 5.65E-06 5.65E-06 mr1464_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 3.47E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 5.53E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 1.60E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 5.94E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 9.61E-06 NA mr1854_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 7.55E-06 2.99E-09 mr1885_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 6.98E-06 6.98E-06 mr1885_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 3.79E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 2.62E-06 5.98E-06 mr1909_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 NA 6.25E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 9.96E-06 7.36E-06 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964 7.69E-06 7.69E-06 mr1981_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251