Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115066964:

Variant ID: vg1115066964 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15066964
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AAGATCCTCCAATTTAACGTACTTACTTATTCTCGTGCAATAGCCCGAAGGAACTTTAATATTTGCCAGACATGATAGCATTGCAATCTTCTCATCCTTC[G/A]
ACAATGTGTGGCAAGCTGGTGGGAGGTACACTCTTCCTGTCTTCTCATCTGTAACAGGCTGAAGTTCACTGCGAATGTTCATCTCCTGTAGATCGAGACG

Reverse complement sequence

CGTCTCGATCTACAGGAGATGAACATTCGCAGTGAACTTCAGCCTGTTACAGATGAGAAGACAGGAAGAGTGTACCTCCCACCAGCTTGCCACACATTGT[C/T]
GAAGGATGAGAAGATTGCAATGCTATCATGTCTGGCAAATATTAAAGTTCCTTCGGGCTATTGCACGAGAATAAGTAAGTACGTTAAATTGGAGGATCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	36.10%	0.38%	0.30%	NA
All Indica	2759	94.90%	4.30%	0.43%	0.36%	NA
All Japonica	1512	3.30%	96.70%	0.00%	0.00%	NA
Aus	269	97.80%	1.10%	1.12%	0.00%	NA
Indica I	595	93.30%	6.40%	0.34%	0.00%	NA
Indica II	465	95.50%	3.40%	1.08%	0.00%	NA
Indica III	913	97.80%	2.00%	0.22%	0.00%	NA
Indica Intermediate	786	92.50%	5.90%	0.38%	1.27%	NA
Temperate Japonica	767	3.50%	96.50%	0.00%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	86.50%	2.08%	4.17%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115066964	G -> A	LOC_Os11g26320.1	missense_variant ; p.Ser624Leu; MODERATE	nonsynonymous_codon ; S624L	Average:32.811; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	benign	0.178	DELETERIOUS	0.02
vg1115066964	G -> DEL	LOC_Os11g26320.1	N	frameshift_variant	Average:32.811; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115066964	NA	7.19E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	8.09E-06	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	2.83E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	4.14E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	1.69E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	6.86E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	4.88E-06	4.88E-06	mr1262_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	3.72E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	1.02E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	8.15E-06	mr1316_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	2.94E-06	4.69E-06	mr1345_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	5.65E-06	5.65E-06	mr1464_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	3.47E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	5.53E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	1.60E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	5.94E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	9.61E-06	NA	mr1854_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	7.55E-06	2.99E-09	mr1885_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	6.98E-06	6.98E-06	mr1885_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	3.79E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	2.62E-06	5.98E-06	mr1909_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	NA	6.25E-09	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	9.96E-06	7.36E-06	mr1921_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115066964	7.69E-06	7.69E-06	mr1981_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251