\
| Variant ID: vg1114911197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14911197 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.30, others allele: 0.00, population size: 90. )
AACAGATACTGTACGATACAATCGCAGAGGGAACTAGCCAGTACTGGAACGAAGAAGAGGGGAACGATGATCCAAACCAGTACTTGAATGAGGAGGGGAA[C/T]
GTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCATCCCTCTGCTGGACAGAAGAGGGCATGCGGACAACGAGGTGCCGCGAAGA
TCTTCGCGGCACCTCGTTGTCCGCATGCCCTCTTCTGTCCAGCAGAGGGATGACTTCCACTAGCCTCCTCCTCCTCGTTCCCCTCCGCATCCCTCTCCAC[G/A]
TTCCCCTCCTCATTCAAGTACTGGTTTGGATCATCGTTCCCCTCTTCTTCGTTCCAGTACTGGCTAGTTCCCTCTGCGATTGTATCGTACAGTATCTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.80% | 20.60% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 66.00% | 33.20% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 21.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114911197 | C -> T | LOC_Os11g26070.1 | synonymous_variant ; p.Asn169Asn; LOW | synonymous_codon | Average:40.595; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114911197 | NA | 4.25E-06 | mr1303 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.02E-06 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.42E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 7.08E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 4.73E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | 3.43E-07 | 8.92E-10 | mr1424 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | 3.75E-06 | 3.75E-06 | mr1424 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | 1.68E-06 | NA | mr1427 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.08E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.85E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 4.30E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | 9.15E-06 | NA | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.11E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.37E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114911197 | NA | 1.38E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |