\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114490914:

Variant ID: vg1114490914 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14490914
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAACTGCGCCAGTTCGACGGATATCCTATCGAACAGCCCTGCCTGTCGAACGGCAGCCTTCCGATCTCCTCGCCAGTCGCGCTCTGGCTGTTCGATAGGC[A/G]
TCCTATCGAACTGCACCCGTTCGACAGGGACCTACTTTCGCGATTTTCCCCGGTTGACCACTACTTTTGCGATTTTCCATAAAAATAATATTAATTCTCA

Reverse complement sequence

TGAGAATTAATATTATTTTTATGGAAAATCGCAAAAGTAGTGGTCAACCGGGGAAAATCGCGAAAGTAGGTCCCTGTCGAACGGGTGCAGTTCGATAGGA[T/C]
GCCTATCGAACAGCCAGAGCGCGACTGGCGAGGAGATCGGAAGGCTGCCGTTCGACAGGCAGGGCTGTTCGATAGGATATCCGTCGAACTGGCGCAGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 36.60% 1.14% 1.59% NA
All Indica  2759 89.90% 5.70% 1.74% 2.68% NA
All Japonica  1512 3.40% 96.30% 0.26% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.10% 4.90% 2.86% 1.18% NA
Indica II  465 93.30% 3.40% 0.65% 2.58% NA
Indica III  913 85.80% 9.10% 0.55% 4.60% NA
Indica Intermediate  786 91.60% 3.80% 2.93% 1.65% NA
Temperate Japonica  767 3.70% 96.10% 0.26% 0.00% NA
Tropical Japonica  504 3.40% 96.00% 0.40% 0.20% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114490914 A -> DEL N N silent_mutation Average:41.21; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1114490914 A -> G LOC_Os11g25410.1 downstream_gene_variant ; 463.0bp to feature; MODIFIER silent_mutation Average:41.21; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1114490914 A -> G LOC_Os11g25420.1 downstream_gene_variant ; 2091.0bp to feature; MODIFIER silent_mutation Average:41.21; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1114490914 A -> G LOC_Os11g25410-LOC_Os11g25420 intergenic_region ; MODIFIER silent_mutation Average:41.21; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114490914 NA 2.96E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 3.02E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 3.07E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.59E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.00E-26 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.59E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 5.75E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.76E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.44E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 7.11E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 9.75E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 9.24E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 2.50E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 2.58E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.09E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 3.77E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.25E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.21E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.08E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 8.54E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 2.42E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 NA 1.06E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114490914 1.11E-06 3.78E-07 mr1959_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251