\
| Variant ID: vg1114485005 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14485005 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 245. )
TCGGTAGCACCTTTGATACTCGGCTGAGCTGAGCCGTCTGGAGCTTGTTTTCCTTCTCCATCTTTAGAAGAACCGGTCCCAGGATCATCAGCAACCACTC[C/T]
TATCTTGTACTTTTGAACAAGTGTCCCCTTGCGGGTCTGCATAAATGAGTTCAAAAACTGATCCCGTGTTTGCTGCAACGTTGCTTCAAACTCTTTCTTC
GAAGAAAGAGTTTGAAGCAACGTTGCAGCAAACACGGGATCAGTTTTTGAACTCATTTATGCAGACCCGCAAGGGGACACTTGTTCAAAAGTACAAGATA[G/A]
GAGTGGTTGCTGATGATCCTGGGACCGGTTCTTCTAAAGATGGAGAAGGAAAACAAGCTCCAGACGGCTCAGCTCAGCCGAGTATCAAAGGTGCTACCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 34.90% | 2.79% | 14.73% | NA |
| All Indica | 2759 | 68.60% | 2.50% | 4.60% | 24.32% | NA |
| All Japonica | 1512 | 3.20% | 96.40% | 0.07% | 0.33% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 4.90% | 2.02% | 21.18% | NA |
| Indica II | 465 | 50.50% | 1.50% | 9.03% | 38.92% | NA |
| Indica III | 913 | 74.90% | 0.40% | 4.60% | 20.04% | NA |
| Indica Intermediate | 786 | 69.30% | 3.70% | 3.94% | 23.03% | NA |
| Temperate Japonica | 767 | 3.70% | 96.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 3.00% | 96.40% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 43.30% | 4.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114485005 | C -> T | LOC_Os11g25400.1 | missense_variant ; p.Gly78Arg; MODERATE | nonsynonymous_codon ; G78R | Average:26.64; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | benign |
-1.347 |
TOLERATED | 0.05 |
| vg1114485005 | C -> DEL | LOC_Os11g25400.1 | N | frameshift_variant | Average:26.64; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114485005 | NA | 6.97E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | 4.17E-06 | 4.16E-06 | mr1126_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 3.34E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 2.32E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 9.66E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 5.85E-15 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 1.66E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 1.86E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 9.00E-06 | mr1603_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 8.99E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 1.29E-17 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 5.38E-10 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 3.25E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 4.93E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | NA | 3.59E-14 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114485005 | 7.29E-06 | NA | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |